Under the Sky, Above the Earth and Over My Head IX

>Day Happiness is Not a Warm Scalpel in Equestria

>Be Anonymous

>The previous night was exhausting and mildly uncomfortable as you learn that Luna can physically control your body

>You plan to find a way to resist her and you know just the pony for the job

>After the morning's usual activities of eating and bathing, you head out to visit Twilight

>It's a fairly short trip to her library home

>You knock at her door quickly and await a response

>After a few minutes, the door swings open to reveal a little purple dragon

S: Oh, hey, Anon! What's up?

A: Nothing much, bro... you see Twilight around today?

S: Oh yeah, man. Let me get her for you

>Why can't ponies be as levelheaded and bro-esque as Spike?

>Spike invites you in

>You look up from the ground floor to see Twilight Sparkle trotting down the steps

TS: Oh, Anonymous! Nice to see you here. Can I help you with something today?

A: Magic...

TS: But, you're not a unicorn?

A: No, I need defense against magic

>She looks at you curiously

TS: Well, I am not sure if I can teach you something like this... I mean, what are you even trying to defend against? Magic is complex and every spell is different

A: It's... it's hard to explain

>L: Hello! What's going on in this head?!

>You physically jump as the booming voice startles you

>Twilight backs up a bit

TS: Are you... OK, Anon?

A: Yes... yes, I'll be fine...

TS: So, what did you need defense against again?

A: Um... I suppose we can call it telepathy messaging?

TS: Is somep0ny beaming strange sounds into your mind? Because I ended that experiment months ago after seeing it has no observable effect on you

A: No, no, it's... wait, what?

TS: Nothing! Well, I don't know if I can teach you a spell for this kind of thing. Hang on

>She trots down and searches for a book

>She finally pulls one from her many shelves and begins reading through it

TS: Magic... rings... ah! Here we go! There is an enchantment that would allow a skilled unicorn to imbue a magical barrier on an item that -might- be able to block out telepaths from sending messages into your head

A: Would that stop all sound?

TS: It -should-, but it looks like pictures would still get in. Are you seeing strange images, especially images of anything that would seem like heresy to the Princess?

A: No, nothing like that...

TS: Good! Because it says here that Tartarus' minions -could- influence easily susceptible ponies into doing their bidding... hmm

>She looks you over carefully

A: I promise, this is for a simple matter and has nothing to do with bad influences

>L: Anonymous, we are most displeased with your thoughts here. You shall not be able to silence the Princess of the Night! My magic is law!

>A large radio appears in your mind

>Luna looks up at it as the lights begin to flash

>♫If you, want to call me, "Baby"! Just go ahead now!♫

>Luna covers her ears and flails around as she tries to silence the music

>You have drown her out for now, but at the terrible price that this song is stuck in your head

TS: Well, I don't see why we can't try this... but, it's very taxing and I am going to need to charge a fee

>She smiles widely

A: How much?

TS: No bits... I want a four hour long session of asking any questions and testing varies, non-lethal spells on you

>She smiles even wider now and you are nervous to say the least

A: Wow... so this seems entirely crazy... a two hour session instead?

TS: Two and a half hours and I get to test a polymorph spell on you

A: What is that?

TS: A spell that transforms bodies into other bodies... it's also non-lethal, however I can only do it easily on a willing subject... so, what do you say?

>She looks at you with her large eyes

TS: Contract?

>Eh, it can't be worse than your current situation

>You extend a hand and take her hoof in a firm shake

TS: Oh, goody! So, I can't waste this opportunity! Spike, get my collective tome of Anonymous' history!

>Spike salutes and runs off

A: You have a -tome- about me?

TS: Why wouldn't I have a tome about you?

>You shrug with more confusion than worry at this turn of events

>Spike reappears with a massive book nearly twice his size

A: I like the silk and oak binding...

TS: Thank you...

>The compliment is fairly hollow as Twilight loses all focus in her reading

TS: Aha! I am so happy I write these down all the time! OK, this was a good one. Did you have a formal education?

A: I believe so... I did so many years of primary and secondary schooling as well as a year of time in a university for a researching degree in astronomy

TS: Interesting... excellent! Next, how many segments would you say are in the human spine, specifically the number of vertebrae between the thoracic and lumbar segments?

>You look at her and grimace

A: I... am not entirely sure...

>She looks at you and sighs lightly

TS: No worries... I will save that for later... Alright, this is a good one! Do humans have a polyestrous cycle as ponies -or- is it diestrous?

A: I don't even know what those words mean

TS: Simple, really. Do humans breed seasonally, polyestrous, or do humans breed twice a year, diestrous?

>You think for a moment

A: Humans can breed any time they want, I believe... I guess more people conceive during the winter months, what with vacations and confinement. Humans are kind of like bunnies!

>Epiphany!

TS: Oh? Now I would have never guessed that... but, you're too tall and you eat so much? Would that mean that humans only have one foal at a time?

A: Yes, exactly. A woman has, on the average, one -child- at a time. There are oddities, like having twins or more at once. That is a rare though...

TS: Incredible! You can breed whenever, but have near identical breeding circumstances as ponies! How long, in days, does it take to have a human child?

A: Uh... normally  nine months and that would be about... 270 or so days. It's not too uncommon for children to be born a month or two earlier than the expected date

>Twilight frantically jots notes as you speak

>In this state, you could almost swear she's a real scholar

TS: OK... do you know the parts of a human female's anatomy?

>You smirk and puff out your chest

A: I'd like to think I do...

>You chuckle a bit

TS: Excellent! Please draw a diagram for me and make sure to label each part of the reproductive tract as closely as you can. I need accurate anatomy charts to compare everything

>You cringe and look at Twilight's completely casual smile

A: Well, I don't know it -that- well...

>You kick your foot a bit and shrug

>You wish you had a book to give her on this

TS: Well... those are all the major questions I think I can get out of you... so, that would mean

>She looks at you with starry eyes

TS: Practicum time!

A: Say what now?

>She leads you down the stairs to the ground floor and to a bookcase

TS: Open Sesame Seed!

>Her words echo and the bookcase fidgets and slides to one side

>You see a winding staircase descend into dark nothingness

A: Neat trick... well, guess it's time for me to go!

>You turn and begin to walk out before a tug of magic grabs your collar

TS: You said I'd get two and a half hours and non-lethal spell usage...

A: So, why do we have to go where no one can hear me scream?

TS: Oh, Anonymous, you silly colt... this room doesn't have soundproofing just yet...

>She drags you along with her and you see the light fade from view

>Small lanterns guide you down as you are pulled deeper into the very earth beneath you

>You finally reach the bottom and come to an artificially lit room

>The walls are painted white and a smooth table sits in the very center

>A shiver crawls up your spine and straight to your brain as you imagine what Twilight does down here

TS: Welcome to my testing lab! The walls here are magic resistant and block most outside spells and contain anything cast inside it. Now, if you would be so kind as to get on the table

A: I don't wanna...

TS: Come on, you're wasting valuable research time!

A: What are we going to do on the table?

>Pomf

TS: I am planning to run some routine tests on you, mostly biological tests to see more about what makes you work...

A: If you pick up any instrument sharper than a sponge, I don't want anything from you ever again!

>She smiles

TS: No, no... vivisection is reserved for unintelligent creatures...

>You cringe and cautiously walk to the table

>You lay down to find it is not as hard as it looks

>The metal must be magical or something

TS: Comfortable?

A: Should I be?

TS: Of course! I need you to relax so this spell will be effective

>You breathe easy and try to think of a happy place that is not underground

TS: Alright! This is going to be a long test, I still have two hours remaining... and four minutes... so, the first test will require some fluid measurements

A: Which fluids?

>Twilight holds a beaker to her face and smiles

TS: All of them...

>A bolt of magic zaps you and you feel oddly breezy

>You look at your skin to see that... you can see through your skin

>Your muscle and sinew is exposed and you do your best to not freak out

TS: Look at that! Amazing structure! Now, please remove your clothes. I want to get a good look at your organs next

A: I don't like this very much...

TS: Please cooperate or I'll be forced to remove your clothes

>You sneer and slowly take off your outfit

>Looking at your body is like looking in a medical dictionary

>Kind of makes you sick to see all the processes in real time

>A long while passes as Twilight bounces around you with a sketch pad

TS: There we go! Drawing your digestive tract was a real chore! Human parts are pretty complex, but not entirely dissimilar! Hold still again...

>Another zap of magic makes your skin burn a bit  

>You have the strangest taste of blue on your tongue

>You see your skin start to take colour once more

A: Thanks! I was missing being opaque...

>You see your groin flesh back out and cover it with your hands

A: Mind handing me my pants?

TS: Not yet, I need to draw this... your penis and scrotum...

A: Really? I don't remember...

TS: Full-body study! We're almost done and I barely have thirty minutes left!

>She's really good at keeping time

A: Fine...

>She eyes your sack for a while and draws now and again

>This is not fun in the slightest

>You barely take your junk out in the light around Applejack

>Your mind snaps to as you feel a quick rush of air and hear a sniff

A: Hey! Watch it!

TS: Why do you smell like apples?

A: Because... reasons

>Twilight thinks for a moment

TS: Oh, wow... have you and Applejack been breeding?

>Just be cool about this

>Twilight is sort of a friend, she shouldn't get mad at you

A: Now, listen... Applejack and I are pretty steady...

>She cuts you off and smiles widely

TS: I had no idea if your body was mature enough in pony terms! Oh, you have to tell me everything! Was it pleasurable or did it hurt? How long and wide are you at full length? Is it relatively the same as copulation with female humans? How many instances a day do you two copulate? How long, on the average, do you rut for? Is it possible to...

>The barrage of questions keeps up

>You just kind of sit there in your barely covered position

>She finally stops talking and looks up at you with hugely curious eyes

>It's like a small child talking about candy

>Only this is infinitely more disturbing to you

TS: You know what? This is a lot to ask you and I am sure it's very personal

A: Oh... thank you for understanding... now if you could...

>She raises a hoof

TS: I'm not done... we have twenty-seven minutes and are still in my workshop. We could answer all of these questions with time to spare the easy way

>She hops to her hooves and wags her bottom before you

TS: Go ahead, Anonymous. I think you'll find that I am nearly proportionate to Applejack. Oh, so exciting! Physical application of theories is the best!

>Her tail lifts up and sways before her

>She cranes her neck around and looks at you

TS: Why are you wasting time now? Hurry up!

>You are kind of confused

A: Are you... coming onto me?

TS: What? No! Don't be crazy! I just need to you insert you penis in me while I use this spell to record data

A: So, you're trying to get -me- to have sex with -you-?

TS: No, no! This won't be sex! It's research! Now, hurry up! Only twenty-five minutes left!

>She leans her front half down and curls her tail around her flank

A: If I said I didn't want to screw you...

TS: For the last time! This is -not- sex... I just need you to ejaculate inside of my body as quickly as you can and as many times as you can for data! The metrics are falling apart for every second you waste!

A: Twilight, I am not doing this...

TS: Why not?! You promised to do all the research I wanted for two and a half hours!

A: I did -not- think it would lead to this!

TS: That's why I am so desperate! We have so much science to perform and you're just sitting there!

>You feel your member being tugged by Twilight's magic

A: Hey! Take it easy! Pulling like that is going to rip something!

TS: If you don't hurry up, I'm going to take action myself!

A: I don't want the ring anymore. I'm leaving...

>Twilight's face goes pale

>She turns around to face you

TS: What? But, my notes! All the research! It's so close to complete! Please, Anonymous, don't leave until it's finished!

>You heave a sigh and look at her

A: Is there another way we could do this?

TS: I suppose so, yes!

>She hands you a cup

TS: Ejaculate into this. I want to see how many milliliters you produce

>She has the creepiest smile on her face right now

A: Is there... another way?

>She looks frustrated with you

TS: I... I, ugh... not really! Maybe we could just go for a distance test? You can masturbate in front of that colored stripe and I'll record how much velocity you ejaculate at? Choose something fast, we only have seventeen minutes left!

>You shake your head

A: I don't really feel like doing this at all...

>Twilight rubs her chin for the moment

>She smiles widely and nods

TS: I understand! Your species is based around visual cues and you just can't form an erection! Say no more, I'll handle the easy part

>Before you get to speak, Twilight's horn glows brightly

>The light blinds you for just a moment

>When you can see again, Applejack is standing before you

>You look around to see a clear sky over head and rows of apple trees on either side of you

>You're sitting on the table still, but everything else looks and even smells like Sweet Apple Acres

>Applejack approaches you

TS: There! Is this a better atmosphere for you?

> C'est quoi cette merde?

>Twi-jack turns around again and presents her hind quarters to you

TS: While I can't say for certain that you and Applejack have had intercourse outside in the orchard, I would imagine it would happen. Having said that, you should really hurry up...

>Your mind is full of fuck right now

A: Twilight...

TS: Call me, "Applejack" to improve the immersion

>You look sternly

A: I am not going to do that

>Twi-jack clears her throat for the moment

TS: But, An-on, ya'll rilly got to hurry on up an' rut mah bottom!

>This is borderline mind rape

>Feels like you're in the Twilight Zone... the show...

>Not this actual zone created by Twilight... fuck

A: Look, I just want to get off this wild ride!

TS: What? We're not on a ride! We only have ten minutes... can you get moving? I mean, "Can ya'll git a'movin'?"

A: Lord, you impersonations are awful...

>Twi-jack turns around to you again and sighs

TS: Do you want that magic ring or not? This feels like a big waste of perfectly good experimenting time now and my butt's getting cold from wagging it in the air so long! We have almost no time left now and if you don't give me -some- data, this contract is over!

>You're little stallion rises as you look at Twi-jack's shapely backside

>You try to press it down, but it's not fooling anyone

TS: Oh? Interesting... Perfect! Now, simply put it in me. I would prefer it in my vagina as I could take the most accurate measurements that way

A: How does that even work?

TS: Easily! I cast a simple spell that allows me to feel things in both quantity and quality and allows me to quantify sensation as well as physical changes. I'd be able to record all kinds of data!

A: Well, even if you look like her, you're not. I'm not going to play this game. Just... take what you want and be done with it...

>She smiles widely

>That beautiful smile of your gorgeous, green eyed mare

>Your mind dreams of her for the moment

>A sudden cool, wet feeling snaps you back to Twilight's reality

>You see Twi-jack's face beginning to swallow your maleness

A: OK, fine... but, I won't enjoy it...

TS: Enjoy this? Impossible! This is -not- sex

>She returns her lips to your sex and takes you into her muzzle

>Almost immediately do you find that Twilight is rather inexperienced at this

>Her teeth bump your sensitive tip multiple times and her tongue seems to get in the way

>It's seriously impeding your orgasm

>You dare say this is the worst blowjob in the history of the act

>Twilight removes you for a moment

TS: Oh... we only have two minutes and you've still not ejaculated... my mouth is sore and it's going to corrupt the data if I continue like this...

>Her whining almost makes you feel bad... almost

A: How about we forget this whole thing ever happened?

TS: Why are you being so mean and uncooperative?

A: Pardon? I have been the best subject of any experiments I've ever seen

>Twilight lets out a sigh of defeat

TS: I was hoping you'd use my backside because... well, technically speaking, I'm really not good at this whole... sex thing

>She looks away shyly

A: Can you drop the Applejack image? It would improve my feelings at the very least

>The room flashes brightly again

>You close your eyes this time

>When you open them, you are back in Twilight's sterile lab with a purple unicorn staring at your crotch

TS: We only have a minute now... less now... even less now

>You hop to your feet with a raging erection

A: I am sorry, really... I just don't like doing it with other ponies

TS: I keep telling you, it's not sex. I just wanted to finish these metrics and close out that chapter of this book. It's going to be the best guide on humans ever and it needs to be accurate

A: How many other humans do you know of that you need a safety guide on them?

TS: Well, I know you... and what if other ponies want to know you? They all can't meet you... that's what books are for! You can read about the things you can't see or do...

>She looks down at a blank page and traces it carefully with a hoof

>This is fairly depressing

A: Look... I... I just can't do this behind Applejack's back. I feel awful

TS: What if she sanctions my research?

A: I... don't even understand how to feel about that sentence!

TS: If Applejack says it's fine for you to ejaculate in me for the purpose of my research novel, would you?

A: I don't see why she would do that... but, if she did, for whatever reason, I guess I would

TS: I realize you are based on both your mind and senses when it comes to sex... does that mean you really don't find me as appealing as Applejack?

>Oh boy... now this...

A: That's not it... I love Applejack. She's amazing! You an I, we're just barely friends. We don't really even associate with each other outside of these rather specific scenarios

TS: Yeah, you're right...

>She clutches her book tightly to her chest

TS: I was going to give you a copy when I'm done... it is a book about you, after all. I just want it to be right. Maybe, when you read it, you'll see that I tried really hard to get to know you... sometimes, I just have trouble making friends with ponies... people... both now

>You stroke her mane gently

>You bring yourself to her height and hug her

>It's kind of awkward when you're naked, but she's warm and soft on your skin

A: You don't have any problems. You have five great friends and we could certainly try to be closer... if you stop trying to kill me

>She looks at you with misty eyes

TS: I didn't mean to hurt you... I just wanted to have all the facts

>You pet behind her ears

A: Well, just treat me like you would treat any other pony. I would like you a lot more if you'd stop experimenting on me... and if you gave me back my clothes

>She sniffles and you see your outfit conjured through her magic

A: You're alright, Twily...

>You nuzzle her head and she smiles

>You stand to your height and carry your clothing to one side of the room

>Your maleness is still throbbing despite everything

>Maybe there is a way you can still help Twilight...

>You reach for a measuring cup and set to work

>Racing thoughts of Applejack in you head, you spill in record time

>Your aim could be better, but you got most of it in

TS: Anon? What was the sound?

>You sigh and shiver happily to have that out of you

TS: Oh... did you just?

>You present her the cup of you

A: Here... don't say I never gave you anything!

>You proceed to dress yourself

>While you are busy, Twilight stares intensely at her "gift"

>You see a flash of blue light engulf the cup and it vanishes

TS: Oh~! So much data...

>Twilight looks a little fuzzy around the edges as a smile creeps along her snout

>She hums lightly to herself

TS: Amazing! ATTAGCCGATGCGCCTAATTATATAGCGCAT! Whoa, that's a lot of pairs... better start writing this down! You know, your semen is not very different than a ponies! Comparably salty, but I attribute that to your peculiar eating habits

>She smacks her lips a few times

>Twilight fiddles with a quill and her notepad for some time and you simply wait around

>After so many minutes, you catch her attention

A: Do you have everything you need?

TS: Not everything, but this helped a lot! I thank you so much for that sample!

>She holds her sketch book to you and you see she is drawing a double spiraling ladder with the letters AT or CG on any given line

>You're no molecular biologist, but cartoons have taught you all about super-science!

TS: Yes! That works! Now the DNA can properly overlap! Oh, I wish I had more research notes on this... if only there was a way to see these tiny structures first hoof...

A: What about an electron microscope?

TS: A what?

A: I have no idea... I stopped watching the show to go to work

>You frown

TS: Well, at any rate... this is great stuff! Now, I have to uphold my end of the deal

>Twilight's horn glows for a moment and her eyes fill with energy

>While charging, you see her staring intently at your chest

>Her horn's glow lowers, but her energy charged eyes remain

TS: What is that symbol on your chest? Take off your shirt again

>Oh no, can she see it?

TS: Somep0ny has cast a binding spell on you... but, who would do that?

>You laugh and turn around

A: Oh that? It's nothing big... you know how all the cool kids are magically soul binding each other these days!

>Twilight's magic completely fades and she looks you over

TS: Is this why you came here for magical defense? Honestly, that aura is too strong for my skills. You should have just told me about that mark earlier!

A: It's... it's from Princess Luna

TS: What? Why would she need to bind you?

A: I don't know if I can say because she can read my thoughts and emotions. I am not sure if she can currently hear me, but I haven't heard from here since we came down here...

TS: Oh, well, if it is the princesses... I wouldn't want to get in their way. Is it something important?

A: I believe so... it's difficult to explain and I don't really want to get into it

TS: Understandable! Royal business is usually discreet

>You nod

>The two of your climb the stairs back into the world

>It's good to see sunlight again even if the sun is already setting

TS: Well, I suppose I couldn't do anything for you... I am sorry

A: It's... fine. I don't even really mind. I do have to meet Applejack tonight, so I'll be off shortly

>Twilight looks at you quickly and nods her head as if agreeing with herself

TS: I -think- there's something I can give you in the name of science and metrics that would be beneficial to the both of us

>A sly grin crosses her face

A: Don't make me see-through again or so help me!

TS: No, no... I think you'll enjoy this spell a lot more. Applejack will, at the very least

>You barely register her comment before a beam of pink light blasts your crotch

>You are knocked to your knees as a pain envelopes your groin

A: And after everything I've done for you today!

>You clutch yourself carefully and whimper

A: If you broke anything down there, I'm going to shave you bald and feather you...

>You look in your pants to see... oh my...

>You giggle a little and reach down

>In your palm is a thicker, weightier piece of meat

TS: If my calculations are right, at full erectness, you should have nine inches of length from tip to pelvis and one and a two-thirds inches in diameter. Just be careful using it the first few times

>You fond yourself in the light and beam over your flesh

A: What's this pink mark around the base here?

TS: Metering...

>You cock an eyebrow at her

TS: Well, if you end up touching that pink line, I'll be able to recall the data. Nothing too personal; just velocity, time, season and amount of ejaculate released...

A: I would be angry, but I have a nine inch dick! It's pretty much worth anything you're saying

TS: I am glad you see it that way! Have a good night with Applejack and, um... thank you for everything. You're really a good friend...

>She trails off a bit and looks at you timidly

A: It was... not bad! See you soon?

>Twilight's ears perk up as she looks at you

TS: Oh? Yes, yes of course! We should see each other again soon!

>She taps her hooves together as you wave to her

>You make your way back to your home and tidy up

>Squat, trim and bathe

>Something about this routine makes you feel like it's a whole new day...

>You chuckle to yourself

A: No, that would be silly if...

>You hear a knock at the door

A: Whoa...

>You strut quickly to the door and open it to see Fluttershy standing in your way

F: Oh, hey, Anon! Glad to see you are home... are you alone?

A: I -might- be... why?

F: I need somep0ny to talk to and, well, you're the only one in town today

A: I'm sorry, but I'm not a pony either! Looks like you'll have to bug someone...

>She steps through you easily and rests on your couch

F: I miss sleeping here...

A: FlutterButt, I did not invite you in

>She lays on her side and rests her head on a pillow

>A happy sigh escapes her lips

A: Flutters... I am leaving very soon...

F: Oh, sorry, I'll be quick... I've been having a problem the last few days. I've been thinking about you so much, but it's not like usual. Usually, I would just try to guess your fetish and hope I was right so that you'd finally love me. I realize now that it's not working... and then I thought of you and Applejack

>You rub your eyes and sigh

A: Flutters, I am sorry... but, really, it's not going to happen between us

F: I know and that's why I came to you for help. You don't love me, but I love you! How do I just stop?

A: I... I don't know? Just, go find a nice stallion?

>She sighs

F: I've actually tried that... they aren't like you. They don't make me happy like you do. Even when you would throw me out or yell at me, I never stopped wanting you. Why are you so perfect?

>You laugh harder than you should at that line

A: I get it... no, StutterThighs, my fetish isn't overly sappy exposition

F: I'm not trying to guess your fetish! I... I really came over for advice!

>You feel a tad bit bad about this whole thing

>Worse yet, you still want to see Applejack more than help Fluttershy with her "issues"

F: You see it's not me though, right? Rainbow Dash told me how you two had sex last night...

A: We did -not- have sex!

>L: We see what you want to say to her and we would suggest against this. Do not divulge our intentions or true powers

A: It was... rape! Yes, straight rape... I was asleep and Rainbow just used me. I didn't want anything to do with it

>Fluttershy sighs a little

F: She's had you twice already and Applejack's your true love... I feel so... just so sad that I can't stop wanting you

A: Didn't you drug me and use my comatose body?

F: Yes, but that was -before- I realized how wrong I was for that. I feel so bad that I tried to take advantage of you. That's not love! It's just... just... oh, just me being a big pervey pony! I thought all I wanted was your weird thingy inside me, but now I see that's not it!

>You look at the sun as it touches the horizon and you know you need to be somewhere

A: Look, would it help if I let you sleep here tonight?

F: Do you... do you -really- trust me?

A: Not even a little, but, I need to give you the benefit of the doubt... you get one more chance to be my friend. Not friend with benefits or lover. Understand?

>She nods to you and lays her head back down

A: I need to go out now, however, I'll be back sometime later tonight. Eat whatever you want. Couch is all yours. See you later!

>You smile and wave as you walk out the door

>You can't see Fluttershy's face, but you hear her sobbing as you shut the door

>Why are the quiet ones always crazy?

>No matter! You have a date to keep!

>You race to meet Applejack at the restaurant

>Success!

>As you arrive, you see Applejack hanging around the front door

A: Applejack! How are you? I did not mean to be late, I just had last minute guests

>You notice she is not looking very happy

AJ: So, ya' did remember ta' show up. Ah was jus' waitin' 'round here ta' tell ya' Ah don't want yer fancy super an' Ah don't wanna waste no more time with yew!

>You freeze in place

A: Applejack?! What... I don't understand?

AJ: Oh, ya' don't? Ah'm mindin' mah own business, pullin' an honest day's apple barrel, when lil' miss cloud-strut shows up. Ya' know what she tells me?

>You shake your head in astonishment

AJ: She tells me how yew an' her went down to the springs an' banged like bunnies!

>You hold your hands out and plead

A: It's not true! I didn't lay a hand on her!

>A: Luna! Help me here!

>L: What would you like us to do?

>A: Tell Applejack it's not true! Tell her it was you!

>L: We cannot reveal the mission. It would compromise everything!

 A: I swear, Applejack! You are the only pony I want in my life!

>You try to move closer, but she moves further

AJ: Rainbow's many things, but a liar ain't one'a 'em! Ah jus' can't keep doin' this. If ya' ain't honest with me, Ah honestly don't wanna bother waitin' 'round fer ya'. Goodbye, Anonymous...

>She turns and walks off

>Your heart sinks

>It's as if someone reached deep within your soul and removed a pillar that supported what little happiness you had

>You turn and slowly make your way down the road

>The walk is longer than before and you have a lot of time to think

>L: Anonymous... we are sorry we cannot intervene...

>A: This is your fault, you wretch

>L: We beg your pardon

>A; Don't be stupid... you can feel my hate right now. It must be devouring you steadily

>L: We admit that your passions are burning... the image of strangulation is also rather shocking, but understandable!

>A: Why is this happening to me? What did I ever do to you that you would cause me so much pain?

>L: We mean you no harm in the arts of love. 'Tis a fickle game at the best of opportunities

>A: Applejack just dumped me because she thinks I fooling around with Rainbow! She thinks all I do all day is rut other mares! I am trying desperately to not deal with these ponies simply because they are all rapists!

>L: Anonymous... just calm down. Honesty wears her heart on her sleeve and is prone to raw emotions. Her stubborn nature breaks down when she has time to think on her own

>So, what? You are trying to tell me she'll just come around and forgive me? I really can't believe that!

>L: I am just saying you should let her rest and clear her mind. I know she does not despise you as much as your emotions may think

>A: How do you know that?

>L: The mark on your chest hasn't changed size... she has static feelings for you as a friend

>A: As a friend... not a lover... not a significant other... just leave me alone, you witch

>You physically spit to one side as if Luna could see you

>Your mind is suddenly empty and you feel alone

>The sky darkens and the stars begin to shine

>How you miss the safety of the night before Luna came into your life

>A sudden breeze blows past you

>You turn to see Rainbow Dash hovering nearby

RD: Hey, Anon! Am I ever glad to find you! I was thinking we should...

>You stare her down and pin her in your sight

A: You wicked creature... You filthy, wicked beast! You made Applejack leave me

RD: Whoa... she just dumped you that easily? I had no idea... well, too bad for her, right?!

>You twitch as your bloodlust builds

RD: Hey! So, now that you're free of -her-, why don't you hang out with -me- tonight?

>She smiles a toothy smile

>You don't want her to ever smile again

>A voice suddenly booms in your mind

>L: Anonymous! Let go of this anger! It is not natural!

>A loud Italian opera plays in your head and oppresses Luna

>You see her screaming out to you, but hear nothing over the music

A: Rainbow Dash...

RD: Yeah? What's up?

>You move to her with dark intent

>You grab her body and pull her into your own

RD: Wow, you work fast! Glad to see you're over that workhorse...

>You hands quickly close around Rainbow Dash's neck

>You hear the delightful sound of gagging emanate from her

A: What kind of -friend- would I be if I didn't share the -love-?

>You squeeze her throat tighter as she struggles

RD: A-non! S-stop...! Can't... breathe!

>The music in your head is nullified as an intense pain forms in your chest

>Your grip loosens for a moment before you redouble your efforts

>L: Anonymous! Cease and desist!

>You look at Dash's face as a lovely purple shades her cheeks

>The pain in your chest kicks you harder now

>You lose your grip as your body convulses in shock

>Rainbow Dash quickly gets to her hooves and pulls herself away

>You hear her gasp and cry as she sits in a corner and watches you spasm

>L: This is for the good of Harmony!

>Your nerves feel like they're burning as your blood roils in your body

>A: Go ahead and kill me! I'll take you to my grave!

>The image of Luna in your mind is suddenly buried under a mountain of dirt and stone

>You can feel her fear of being buried alive

>You smile for the moment before the pain causes you to blackout

 

>Be Rainbow Dash

>You gasp and choke as you paw at your sore neck

>What was that all about?

>He was trying to choke you to death!

>That look in his eyes was like an animal about to rend it's food

>You shutter once and look at his still body

>What caused him to fall over like that?

>You move to him with extreme caution and poke his side with a hoof

>No response

RD: H-hey, Anon? Anonymous?

>His body lies motionless on the cool ground

RD: Oh, man... this is crazy...

>You don't know what to do

>He tried to kill you!

>But, now he might be dead?

>You place a hoof near his mouth and feel the faintest bit of cool breath

>You think that means he's alive... or somewhat alive

RD: Anonymous... come on! Get up!

>You got to get somep0ny

>You race to a nearby shop that is just closing down

RD: Somep0ny! Anyp0ny! Call the ambulance! Human down!

>The owner looks at you quickly before catching on

>It's only moments before he is on the phone

>Minutes pass before you hear the siren of the ambulance approach

>Two ponies step out and rush to Anon's body

EMT: You there! Are you alright?

>One of them looks over your face and bruised neck

EMT: Were you attacked, ma'am?

RD: Ah... yes, but they got away... you gotta fix that guy over there!

>The other worker begins filling a syringe with something and injects Anon in the shoulder

EMT: Looks like he suffered an acute heart attack. Stand back...

>The worker's horn lights up for a moment

EMT: Clear!

>A bolt of electric strikes Anonymous

>His body jumps a bit before returning to position

EMT: Don't you die on me, pal!

>Another charge of the worker's horn zaps Anonymous

>This time, you see his fingers twitch and he takes a deep breath

>He sits up and coughs a bit

A: Ah... what the hell... I'm alive?

>The first medic nods to you and then to his friend

EMT: How are you feeling?

A: Like I was woken from a fine sleep...

EMT: Eh, that'll do... how many hooves am I holding up?

A: Uh... one?

EMT: Good... OK, I think this one's going to be alright. Do you want to go to the hospital?

A: No, I'll shake it off

>The workers shrug

EMT: Suit yourself, buddy. We can drive you to your house, if you want?

>You see Anon exchange dialogue with the workers

>They help him into the vehicle

>Another approaches you

EMT: Ma'am, I'd call the local authorities and tell them everything you saw and who attacked you. I'd stay in the air if your assailant wasn't a pegasus

>He waves and leaves

>You fly up onto a nearby roof and sit on the edge

RD: That was crazy... Anon tried to kill me and then almost died trying! What came over him? I need to go find Applejack and ask her what's up

>You flutter up and take off in the direction of Sweet Apple Acres

>You just hope Applejack's still awake this late at night

>A feeling of dread consumes you as you think about how absurd the last twenty minutes have been

>You just hope it will be more normal at Applejack's place

>Well, only one way to find out!