- >Night Doctorate of Friendship or How I Learned to Stop Stressing and Embrace the Magic in Equestria
- >Be Anon
- >You somehow managed to spend one entire day helping Fluttershy move without her once attempting to guess your fetish or molest you
- >You feel that this is redeeming of her true nature: Kindness
- F: Thanks, Anon, I was so concerned about the recent bunny-boom I had in population
- >You see the extra baby bunnies are no safely in other pens and Angel Bunny is set off to the side in his own cage
- F: I wouldn't believe that Angel could get 121 other bunnies pregnant in one night. I'll have to start adding a sterilizing agent to the carrots
- >Oh, Fluttershy, you sure say wacky things
- >You shake her hoof to end the day and she leaves a few bits in your palm
- F: It really means a lot to me. I didn't think you'd show up when I left that hastily written note at your door
- A: Of course I would, you are still a good friend of mine. Even if we have our... differences
- F: I am glad to hear that... hastily written notes wouldn't happen to be...
- >You place your hand over her muzzle quickly
- A: Fluttershutter, lets keep this magical moment alive, shall we?
- >She nods and tries to say something
- >You smile and quickly make haste from her cottage
- >Being trapped this far from town with Fluttershy is probably the worst thing you could do
- >A few minutes of walking and your stomach growls
- >Well, you have a few bits on hand
- >You decide to go to Ponyville and see if there's a restaurant open this late
- >You arrive to see the town mostly quiet
- >One small building catches your attention with a lantern in the window
- A: Oh... I can't remember ever seeing that place open in the day
- >You wander closer and look inside
- >It seems mellow enough
- >Some ponies are sitting at a stool, drinking cider, presumably
- >Others are play what looks like billiards and darts
- >A small piano is sitting idly in a corner
- >You shrug and decide to go in
- >The moment you enter the threshold, all eyes are on you
- >You scoff, puff up your chest and stride to the bar
- >Mutters follow you, but you pay little heed
- Bar Keep: What can I get ya, human?
- >You don't like his tone, but what else can you do?
- A: Something strong... and something green
- >He slides a shot-glass full of something bright orange down to you and a piece of celery
- >The bar keep chuckles
- BK: Drink up, boy...
- >You feel the patron's staring you down, time to impress them
- >You take the shot-glass and chug the contents in a minute
- >You slam the glass down because all old movies have taught you to do this, stop over thinking, jeez!
- >The fluid burns from your throat to your gut and your eyes water
- >The barkeeper chuckles again and the mood seems to lighten
- >Success! You probably shaved a year off your life, but you have found a measurable amount of recognition
- >You spend the better part of the night and even make a few new friends here
- >All these good times come to a dramatic end when -she- walks in
- >Patrons move to either side and clear a path for the pegasus
- >Her chromatic mane and pert wings signal the end of whatever good time you may have had
- >Rainbow Dash has arrive and makes a beeline to you
- RD: Whoa, Anon? I had no idea you came to this hole
- A: Eh, first time, actually. I was just about to go though
- >You go to stand and a powerful hoof pins you back down
- RD: What's the rush? I just got here
- >She smiles, baring her shiny teeth
- RD: Yo, Moe, two shots down here! The usual!
- >Rainbow calls to the barkeeper and he responds faster than you thought his old body could
- >She snatches one cup and gulps it down
- >Her wings brush against you as her face burns red from the drink
- RD: Take it, Anon, on me
- >You accept her kindness and take a quick gulp
- >This is the same horror you first had to drink
- >Your mind aches as you think Rainbow Dash lives on this stuff
- RD: That's pure, red fractostratus with orange cumulous... stuff's so potent, it's not sold in Cloudsdale anymore. Sucks I have to come all the way here for it...
- >You look at Rainbow carefully
- >Her nose has a bandage over it and her left wing is a little scuffed
- A: Rough day of training, I take it?
- RD: Huh? Oh, you mean this thing?
- >She points to her nose
- RD: Spun out on a dive, no big deal. I just gotta turn faster next time
- A: I do admire your unbreakable spirit
- >Twilight would often joke that Rainbow Dash was more likely to break every bone in her body and still have the will to try again
- A: Other than this... drink... what brings you here?
- RD: Oh, I got a letter from Fluttershy earlier. She needed my help with something or whatever. I came by and saw you working the gig instead, so I took a nap
- A: Oh, yeah, bunnies...
- RD: I figured it was something easy enough. She also ordered a snow cloud for tonight. Beats me though
- A: A snow cloud? How does one order that?
- RD: Just gotta talk to yours truly
- >Rainbow patted a hoof to her chest
- A: I'll remember that, but I should be going... I have... things to do tomorrow
- RD: Pfft, I hear ya. Cloud busting at 6AM... who even wakes up that early to see clouds?
- >You shrug and attempt to leave again
- >As you exit, you hear the sound of hooves behind you
- >Rainbow Dash is following you closely
- >She's such a bully to you sometimes, you can only hope she's feeling generous today
- RD: So, Anon... you got any plans for tonight?
- >Her words are a little slurred
- RD: 'Cause I don't feel like headin' back ju~st yet *hic*
- >You hold out your hand
- A: Give me your keys, Rainboom... you're too drunk to fly
- RD: I don't have any keys
- >She looks crossed with you for a moment
- A: Well, you should take a rest until you sober up. Do you always drink so much?
- >She flies into your face and you step back
- RD: I' m not drunk, you're drunk! ... And kind of cute...
- >You already know where this is going
- >You're too genre-savvy for this shit!
- >You make a mad dash for all that cash around the outside of the bar
- >Rainbow Dash flies in a little zigzag as she chases you
- A: Rainbro, don't be like this! You'll only regret it!
- >Hot damn, the alcohol is making your vision blurry
- >All this excitement is pumping blood faster, in turn, making the alcohol course through you
- RD: Aww, come on, Anon. I was just messin' with you. I won't do nothing you wouldn't like
- A: I've heard that before!
- >You keep running
- >You see the rainbow trail close behind
- RD: I promise I won't even bite you... hehe, if you're good enough
- >You don't know if this is a sexy threat or a regular one... best not to find out
- >You throw yourself in an alley way and hide behind a barrel
- >You've learned from years of video games that barrels are the best place to hide
- >Rainbow Dash flies by and you see her after-burn disappear
- >Success again!
- RD: Whoa, nice moves. I didn't know you were so agile
- A: Ah ha, I am full of surprises, Rainbow...
- >You turn to see she is right behind you!
- >Oh, dear, sweet mercy!
- >You go to run, but Rainbow pins you
- RD: Why are you fussin' so much, Anon? Anyp0ny would be honoured to have me on top
- >I see why they call her, "Top Cunt" now... yes...
- A: Look, Dashie, you're drunk and not thinking right. What would ponies say if they catch you doing me?
- >She stops grinding your pelvis for a moment and puts a hoof to her mouth
- >She smiles and leans closely to you
- RD: I think I'd like to see me riding you. You know how scared other ponies are that a predator is living in town?
- >Her thighs are moving of their own accord now
- RD: yeah, so many scared, little ponies talk about the big, bad human. It's almost sickening how nice you are and they just don't know
- A: Well, I am glad to know that you don't think I am a monster...
- RD: Ut, ut, don't put words in my mouth. You'd have to be a monster to not want my body
- >She whispers slowly
- RD: Don't you know everyp0ny wants to cum inside Rainbow Dash?
- >Her tongue traces your eyes and she breathes a hot, wet breath in your face
- >The smell of alcohol is strong enough to pickle an egg
- A: Dashington, what would I have to do to make you stop this right now?
- RD: Today's been a rough day, Anon. I don't think I can end it gently now
- >She's not trying to undo your pants
- >Maybe she's just trying to bully you after all?
- RD: I admit, you're tougher than I thought after all. You won't get hard just from this alone
- >Oh, she was waiting. How considerate
- >Rainbow puts a hoof under your head and lifts you slightly
- >Her muzzle comes down and her lips lock onto your own
- >Her tongue overpowers you and takes control
- >You can't do a thing against Rainbow's powerful kiss
- >You feel that this may awaken the kraken
- >Boner, no! What are you doing?!
- >Assuming direct control
- >No, Boner! No!
- >You can't believe how hard you are right now
- >Rainbow breaks the kiss and smiles
- RD: Nop0ny's ever been able to stay soft with that trick
- >She wipes her muzzle and bounces against your strained crotch
- RD: I think you're ready... but, I wanna be sure you know your place...
- >Dash smiles wickedly at you as she drags her hot body from your groin to your chin
- RD: ~Boop, ~boop, ~boop... come on, I know you know what to do
- >Her sex bumps into your chin, you get the picture
- >You whimper and give Rainbow what she wants
- RD: Oh, yeah, that's the spot... you're tongues way soft! How do you get it like that?
- >You mumble with a mouthful of Rainbow goo
- >Rainbow Dash lightly smacks your head
- RD: It's rude to talk with your mouth full. Jeez, you think you'd have more manners
- >This wicked harpy is going down for that
- >You bury your tongue into her and feel for her softest parts
- >A few "oohs" and "aahs" gets you just where you want to be
- RD: O-OK, Anon, now for the real fun
- A: Oh no you don't
- >You muffle
- >You wrap your arms tightly to her thighs and grind her into your waiting mouth
- >Rainbow melts for a moment before trying to pull away
- >Your expert cleaning skills have her body on the edge
- >Even her wings don't have the strength to pull her away
- >Rainbow gives in as her marehood falters
- >Her hooves clasp to your head, begging to go deeper
- >You oblige and straighten your tongue to a thick, silky point
- RD: Oh~!
- >Rainbow Dash squeaks before gushing her lewd fluids into your mouth and over your face
- >You choke in surprise as you try to swallow and breath
- >You feel like you should have followed those swimming lesson Kira gave you more closely
- >When the lusty mare's urges are finally sated, she climbs off you
- RD: Fwooh... Now that was a work out...
- >You lay in place
- RD: I didn't think you'd be so reckless and just grab me... I kind of like you more, Anon. You definitely earned some respect for taking the bull by the horns
- >Eh, mare by the legs, but whatever
- A: So... are we done?
- RD: Oh, definitely for now... I haven't had a good, full body, wing stretchin', leg shakin' orgasm in months. I really don't think I can last that long ever again! So, I'm thinking we meet at your place in like a week? Maybe three days...
- A: Rainbow, I'm flattered that you enjoyed my tongue so much... but, we can't be...
- RD: If -we- can't, then -who- can? Fluttershy? She's told me all about how hard you are to get
- >You look over Rainbow quizzically
- A: Is -that- the reason you had to try?
- RD: Oh yeah, you know how I like a good challenge
- >Dash shadow boxes and flitters on her wings to punctuate her point
- RD: But, hey! Don't sell yourself short, Anon. I've been thinking about trying you out for a while now. You can't think I'm the only mare in town who wants to try the, "carnivore"
- A: Oh disgusting! Is that really my nickname?
- RD: Nah, but it's basically what's attracting everyp0ny. I even heard Twilight said she'd like to get "closer examination" on human fizz... fizzlo... fizzolgee...
- A: "Physiology?"
- RD: Yeah, that egghead word! So, like I'm tellin' ya, and I'm only tellin' ya so you make the right move and spend lots of time with me, you can expect lots of other mares to try to get you in, on and around them
- A: Ugh, come on, you can't be serious? This is like the premise of a bad anime. Surely, Applejack is sensible in all this?
- RD: Old honest pony? Nope, she flat-out told me that if Fluttershy got you and said you did a good job, then she would give you a try. By the way, Applejack likes the rope... like, a -lot-
- A: I almost can't believe you're telling me this... it's all so sudden?
- RD: Pfft, not my fault you can't take a hint when mares give it... I figured it was just like humans?
- A: What are the mares doing that suppose to tip me off?
- RD: Jeez, swishing their tails at you? Giving you all these baked goods? tell me you noticed that even Pinkie Pie giggles at your jokes?
- A: Oh, come on! I thought all of that was just ponies being nice?!
- >Rainbow shakes her head at you
- RD: Nice? Anon, when is anyp0ny just "nice" for no reason? I'm only warning you about everyp0ny because I think you'll see I'm the best and you'll put your little stallion in me first
- >Dash taps a hoof to your crotch
- RD: Anyhow... I'm starting to come off the alcohol high... and the orgasm... so, I'm taking off for the night. We should do this again soon. Like I said, your house is way more comfy. I know you have at least that red couch to lay on
- >You cover your face with you hands and shake back and forth
- >This news is terrible!
- >It's awful!
- >It's... it's... it's the start of a new series of wildly implausible events!
- >As Rainbow Dash flies off with a smile plastered to her smug face, you lay and think
- >Pinkie Pie... Applejack... Twilight Sparkle... Dash and Rarity... all of them are going to be acting like
- >Fucking Fluttershy!
- ------------------------------------------------------------------------------
- >Day My Little Anon Can't Be This Cute in Equestria
- >Be Anon
- >Awake to a glorious sunrise
- >Hop into your shower to wash the filthy, shameful masturbation away
- >You put your face into the curtain of water and emerge slowly
- >Transcendence!
- >Feeling renewed, you hop out and dance about the bathroom in the buff
- >You towel yourself down and slip into your suit
- >A quick glance in the mirror confirms that you are a sexy devil
- >You consider the implications
- >Implying you don't know what the mares are clamoring about
- >A tapping at your window catches your attention
- >It's Fluttershy this fine morning
- >You point to the door and meet her by the threshold
- F: Oh, hello, Anon... how are you this morning?
- A: I am OK, you?
- F: Oh, I am fine. Thank you for asking
- A: So, what brought you all this way?
- F: Well, to be honest... two things. First, Anon, is Loyalty your fetish?
- A: No and... what?
- F: Rainbow told me about how you two went out last night... and... and... how you two...
- >Fluttershy leans in closely
- F: How you two knock hooves
- A: Absurd! We did not do anything crazy. At least, I didn't do anything crazy. Rainboom tried to rape me!
- F: That's not how she told it... she talked about kissing and -feeling- you
- >You see Fluttershy blushing furiously
- >Is it embarrassing her to talk about her friends in this manner?
- A: Look, FlutterButter, I can assure you that it wasn't my finest moment. However, I did -not- put you-know-what in you-know-where
- >Fluttershy covers her face and pushes her head to the dirt
- F: Don't be so lewd, Anon. Um, please?
- A: What? I spoiler'ed it and everything!
- F: It's just too lewd for me
- >Fluttershy's bottom wiggles about
- A: So... I guess you'll leave now and plot your next guess?
- >Fluttershy quickly gets to her hooves
- F: Oh, heavens no! I need to protect you, Anon
- A: Say whaaaaaa~
- >You go on like this for a moment
- F: Oh, of course. I never want any of my animal friends to be harmed if I know I can help it
- A: Excuse me? Animal friends?
- F: Oh, I mean... not like... a pony... type... animal
- >Fluttershy squeaks an apology
- A: Never mind. What is really interesting me is how you think you can protect and how you think that I will allow you to be close enough to protect me after all the insane things you've done?
- F: Oh... well, I was thinking we could let bygones be bygones? What do you say, friend?
- >Fluttershy extends a hoof in a mock handshake
- A: I would say you're up to something... but, if you aren't...
- F: Oh, don't worry, Anon. I remember that politeness isn't your fetish
- >She seems genuinely concerned
- >You shake and look sternly into her eyes
- >You invite Fluttershy in against your better judgment to discuss her plans
- A: Now, tell me. What do you think you can do to stop the other mares from making me their plaything?
- F: Well, I will certainly explain to them why you don't want a relationship with them. The girls would have to listen to reason
- A: Uh-huh... reason... any other ideas?
- F: Oh, well, I could fly over you all day and warn you if I see trouble?
- A: That seems a little more "stalker" than I feel comfortable with
- F: Oh, dear... I see... um, how about you make me your mare?
- >Her eyes flicker and a small smile plays across her face
- F: It would make sense, um, you see? If you smell like me, other ponies would see that you're already taken... and they wouldn't pursue you
- >You give Fluttershy your best deadpan stare
- A: So, in order to not be raped, I must just declare myself a horse-fucker?
- >Fluttershy covers her ears and blushes
- F: Anon, you're so lewd
- >She twitches around on the couch before regaining what passes for "decency"
- F: I am sorry, but I do really want to help you. I even promised myself to be on my best behavior for this
- >You hold your hand up to silence her for the moment
- A: I really, really don't understand what you are all finding so appealing in me. There are at least a dozen stallions you can harass. What's the deal?
- F: Oh... well, if you're asking what -my- fetish is... other ponies make me too nervous and stallions are so... big... down there
- >Fluttershy blushes
- >You take a bit of offense, yet you certainly understand that you are smaller by comparison
- F: When I first saw you and I learned you're smart, well, it became so obvious that we were meant for each other
- A: Well, I've heard worse reasons to want someone. What makes you think you'd even enjoy doing something like that with me?
- F: Oh... I never really thought about that... I could learn to like it?
- >Fluttershy bats her eyes at you and smirks
- A: I've never been this close to the criminally insane before. It's very enlightening
- >Fluttershy gives a little smile and bobs her head
- A: Fluttershy, I...
- >You hear a knock at your door
- >The plot thickens?
- >You open the door to see Rainbow Dash hover around
- RD: Hey, Anon! Just wanted to see you this morning. I was thinking about yesterday and wanted to...
- >Rainbow Dash spots Fluttershy just behind you
- RD: What is -she- doing here?
- >Dash points to Fluttershy and scowls
- A: Fluttershy came to make amends with me for all the almost-rape she attempted. Fluttershy is a -nice- pony and a -kind- friend
- >Rainbow takes in everything you're saying
- >She laughs a bit and holds her gut
- RD: I can't believe Fluttershy tricked you like that! Classic sad eyes and frowny-face?
- >Fluttershy puffs out her chest
- F: That's enough, Rainbow Dash. I really am sorry for what I did and I really don't want to see Anon get hurt with all your... your... horseplay!
- >You look at Fluttershy
- >For the first time, you don't wish she was being held prisoner by bunnies
- RD: Oh, come off it! Everyp0ny knows you want Anon's foals more than anyp0ny
- >Fluttershy blushes, looks to you and then hides her face
- A: Alright, Dashie. You are being too rough right now. What did you even want from me?
- RD: Well, I was going to apologize for leaving you the way I did. I was way too drunk and I didn't even finish you off
- A: Don't worry, I figured something out
- >Rainbow watches your hands move as you talk
- RD: Hehe, gross.... So, yeah, we still on for our date?
- >Fluttershy quickly speaks up
- F: You didn't tell me you made a date with Dash?
- A: -I- didn't. Dashie insisted we do the whole... force me into a corner and assault me thing
- RD: Now, that simply isn't true, Anon. I was gonna let you have the first swing this time
- >Rainbow Dash winks and puckers her lips
- >Fluttershy looks absolutely furious
- >You need to clear your head for a bit
- A: Ladies, I am going for a walk. If I catch either one of you following me... I will be eating flank steak for weeks to come
- >You flash your teeth and make an exaggerated chomping motion
- >Both fillies look at you and then to each other
- >You walk past them and laugh manically
- >It is better to be feared than loved
- >Machiavelli may have been onto something
- >Approximately 30 minutes into your walk, you come upon a small pathway lined with trees
- >You believe you heard about this area due to some event the ponies hold here annually
- >You stroll along the dense walkway and admire the trees
- >The shade is comforting
- >You hear the sound of hooves clacking along
- >Turning to the noise, you see Applejack trotting along with a large bucket on her back
- AJ: Hey, Anon! Fancy seein' you here
- >You smile and nod
- A: Just taking in the fresh air
- AJ: Darn tootin'! Ah'm jus' gettin' back from the market. Woo-doggy, them apples moved quicker than a flat-footed jackrabbit in'a summer storm!
- >You imagine this is fast, haven't not seen a jackrabbit yourself
- A: Great! Always good to hear good news
- AJ: And how?! Wanna head back ta' Sweet Apple Acres with me? Granny's got a fresh pie bakin' off that's jus' beggin' ta' be ate
- >Applejack is always so generous
- >Though she probably has more money than any other pony you know
- >You follow Applejack through the woods and over the hills to Granny's house
- AJ: Granny! Look who's come ov'r fer dinner!
- GS: Eh, what you say?
- >You peak in and wave to Granny Smith
- GS: Oh, Anon's here, why didn't ya say so? Let me get'cha a plate, deary
- >You sit at the table with Applejack and her family and eat pie
- >The pie is so good that it brings tears to your eyes
- >The warm slices of fresh apple and the amazing crust leave your mouth watering as you anticipate each bite
- A: Granny, this pie is spectacular
- GS: Oh, don't try an butter me up, sonny. T'ain't nothin' but an ol' family recipe
- >She mumbles as she collects the dishes
- AJ: Nothin' like a hot meal after a hard day's work
- >Applejack stretches and scratches her back with a hoof
- >You nod and hold your warm gullet with both hands
- A: I think I should be heading out... it's getting late
- >Applebloom looks across the table at you
- AB: Aww, but ya didn't even tell us no stories 'bout yer home this time
- A: How about I tell you two stories next time?
- >Applebloom thinks for a minute before smiling widely
- AB: OK! Ah'll get the gang together fer that one!
- >Oh boy! An audience
- >You wave off Applebloom and Granny as you exit
- >Applejack comes around from another door and meets you
- AJ: Thank ya kindly fer droppin' by
- A: Oh, no, thank you for inviting me and for the delicious meal
- AJ: Shucks, Anon, ya know you're always welcome 'round here
- A: This has been really nice, actually... you know, I swore things were going to be much more distressing today
- AJ: Beg pardon?
- A: Oh, I don't know if you've been told, but Rainbow Dash and Fluttershy have been a chore the last few days. Those mares are really mixed up
- >Applejack laughs a little
- AJ: Oh, yeah, Ah heard all about what ya did ta' Rainbow an' Ah was mighty impressed. She really ain't the type'a gal to kiss-an-tell
- >Oh hell, what did you just do?
- >Anon, you're such a loud mouth
- >Applejack winks at you and slowly moves closer
- A: Now, now, Applebottom... I didn't mean to do anything with Dashie. She came onto me
- AJ: Oh, that's 'xactly the story Ah heard
- >Holy halibut! Applejack knows what a double entendre is!
- A: Look, AJ... I am laying down the law right now...
- >Applejack raises a hoof to silence you
- AJ: Ah ain't like other mares. Ah'm Applejack an' I work fer everythin' Ah got. Ah ain't gonna just hold ya down an' ride ya like Ah know you're wantin' me to. Nope, Ah'm gonna do it the ol' fashion way an' win ya over
- >You study the mare's face for a moment
- >No noticeable twitches, no scrunching
- >This one checks out
- A: Well... OK, I am... not sure how to respond! Thank you for being so...
- AJ: Honest? That's lil' ol' me!
- >You stop and look at Applejack
- >No secrets or lies or fetish guessing or espionage
- >It really makes you feel
- A: Well, because you're doing this in the healthiest way possible, I will not stop you from trying
- >Your emotions are locked in turmoil as your mind races with questions
- >Can you really fall in love with a pony?
- >Do you already have feelings for Applejack?
- >How many licks -does- it take to get to the center of a Tootsie-Pop?
- A: What about the other girls?
- AJ: What about 'em, sugarcube?
- >Her confidence is kind of sexy
- AJ: Oh, would ya look at that. Princess Luna's workin' hard ta'night
- >You look up into the sky to see the stars flickering on and the moon rising overhead
- >Applejack races to you and tugs you to follow
- >You climb a small hill by a solitary apple tree
- >The moon and stars are so close from here that you feel like you could touch them
- AJ: Ah always love the light show... it's jus' simple things that really make me happy
- >You slump to your rump and cross your legs to watch the stars come to life
- >A warm something nudges against you
- >You look to Applejack to see her nestled close to you
- >No words now, only friendship
- >You idly stroke her mane and she gives an approving shiver
- A: I can't say I've ever seen the stars this closely before
- AJ: You should spend some more time 'round these parts. Country livin' is mighty fine
- A: I don't know. I am more of a "city" person, myself
- AJ: Ah don't have much'a the "city" in me... but, Ah'd like ta' get some...
- >You smile at that horrible, horrible flirting
- >As the stars take their place in the sky, you wave to Applejack and take off
- >She smiles and turns to head home
- A: Looking positive, Anon, looking good. ButterThighs is off your case and Applejack is not going to outright molest you. I think you're gonna be fine!
- >Up above in the clouds, a rainbow-mane pegasus is watching you
- RD: Ohhh, that goody four-shoes Applejack always has to cheat! I knew I should have sucked Anon off. Boys love it when you do that! Grrr, now I need to work twice as hard to make him mine
- >You make it home to find Fluttershy has fallen asleep in your bed
- >You kick the bottom of the bed
- >Fluttershy jumps up and looks around
- F: Oh, Anon! You're home... I was worried about you
- A: I see and... wait, is that my tie?
- >Fluttershy smiles nervously and tries to loosen it
- A: Why were you wearing my tie and sleeping in my bed?
- F: If I tell you the truth, you need to promise me not to be angry
- A: Why would I be ang-
- >You see a wet spot on the bed where Fluttershy had been laying
- >You cross your arms and await Fluttershy's story
- F: Well, I was attempting to secure your home... and I found this tie you wear... and I started sniffing it... to check for threats? I, um... I ended up lightly choking myself with it while I... I... you know... on the bed
- A: Fluttershy... get out
- F: Y-yes, Anon
- >She flutters to her hooves and makes her way around the corner
- A: Fluttershy!
- >She squeals and tosses you back your tie before running out the door
- >You sigh and remove the bed sheets
- >Everything stinks like honey-suckles and tea
- >You'll be up for hours now washing your comforter set
- >You consider sleeping on the couch for a moment
- >You notice a pillow is covering another dark, wet spot
- >Fucking Fluttershy!
- ------------------------------------------------------------------------------
- >Night of the Lustrous Moon in Equestria
- >Be Anon
- >Today was rough
- >You don't feel like showering or shaving before bed
- >That can wait until morning
- >Fluttershy is sleeping in your home... again...
- >Her commitment to you is not entirely terrible and she actually hasn't tried any funny business
- >Yet!
- >You have set proper boundaries and make sure that Fluttershy sleeps on the couch
- F: Hey, Anon, Applejack came over a few hours ago when you were out. She, um, left you a pie. I had a little piece
- >The events of the last few days have been... odd at best
- >Applejack is trying to woo you with copious amounts of apple-based treats
- >Rainbow Dash really wants you to go out drinking again
- >Fluttershy turned a new leaf and wants your happiness and safety
- >In times of such peace, you can only dream of the war ahead
- >You find the pie in the kitchen to see half remaining in the pan
- >You tear a piece out and stuff it unceremoniously in your mouth
- A: Mmm, I need to thank Applesauce for this delicious pie
- >Fluttershy seems to blush as you suck your fingers clean
- F: A-Anon... I noticed you've been out of the house a lot more lately...
- A: I've been busy doing odd jobs
- >You hold a small pouch of bits up and jingle it
- >The sound makes your capitalist heart grow and you smile
- F: You've been working for Applejack lately... right?
- A: Well, you can say that... not too many ponies in town who can actually pay me for my ability to reach higher places
- >Fluttershy looks lost in thought
- F: Anon, is Applejack really getting you all to herself?
- A: Well, she -is- a lot of fun and she does have a certain charm to her. If you mean if we're going at it, no... not at all
- >Fluttershy blushes as the implied activity
- >You assure her that all you've done is stroke Applejack's mane non-sexually
- F: I-it might be asking too much... but... do you think... y-you could brush my mane? Non-sexually, of course!
- >Of course
- A: OK... but no moaning this time. If you soak my couch again, you'll be sleeping at your own house
- >Fluttershy looks excited and hands you a pink brush that looks not unlike her mane
- >She lays on her belly and her wings tuck in close to her shoulders
- >You brush her mane for three dozen strokes in one direction, then in another
- >She whimpers slightly as you come down to her shoulder blades
- F: Oh, Anon, you're so good at this
- A: Well, brushing a mane is kind of straight forward
- >You run your hand through her hair a bit to feel its softness
- >Your thumb gets stuck on a small knock
- A: Oops, hold on a moment. Snagged
- >You attempt to slide out, but the mane is holding tight
- >You try a small pull and your finger comes free
- >You see Fluttershy's back leg shake and her wings spread slightly
- F: Oh~
- >She quickly covers her mouth
- A: That was an accident! I didn't mean to! Sorry!
- >Fluttershy is panting softly
- F: I-it's alright... don't... stop brushing
- >You continue, slightly uncertain of Fluttershy's growing blush
- >Her wing gets in the way of her flowing mane
- >You brush the loose ends upward and take hold of the major wing bone
- F: A-Anon... d-don't... stop...
- >You let go of Fluttershy's wing
- A: Oh, sorry! Sorry, I didn't mean that!
- >Fluttershy looks up at you with crimson cheeks
- >She bites her bottom lip and her small frame shakes
- >You know this is all your fault
- >You are a terrible friend, unless...
- >Taking her wing back in your hand, you run your fingers up her quills
- >The mare's yellow down is softer than any pillow you've touch before
- >You trace and tease her tiny wing, slowly working your way up to her body
- >Your finger gently runs across her shoulders and you carefully massage her shoulders
- F: A-Anon... I... Oh...
- >Fluttershy's pelvis is desperately grinding into a decretive throw pillow
- >Your hands work down her long body and you scratch her flank
- F: Oh~, I knew it... Human hands, ah~... so good...
- >You are kind of enjoying this after all
- >It's not like you're doing more than massaging her anyhow, but her little cooing and soft moans are delightful to hear
- >You run a finger in a circle around her cutie mark
- A: Ohh~, do that again...
- >You smile and go around a few times
- >Fluttershy has a look of such bliss on her face
- >You grin as a wicked thought crosses your mind
- >You lift your right hand and bring down your palm with a satisfying whapping noise
- F: Ah~! Anon!
- >Fluttershy's wings perk up and her body convulses into the pillow
- >At once, you smell honey-suckles
- >Fluttershy lets out a gasp as she buries her face in a cushion
- >You rub her flank roughly once
- >Her marehood rocks into the couch with each expert squeeze
- >Something about overpowering Fluttershy in this way was exciting
- >You can't believe how hard you are right now!
- >Fluttershy lays still and catches her breath
- F: A-Anon... y-you... bea~st
- >Her eyes are blurred and she has drool hanging from her pursed muzzle
- >A man could lose himself in this much control
- >You decide you must hide you power level, lest you corrupt yourself
- A: I am... uh, happy? Yes, happy to have helped you... I am going to bed now... you can sleep on the couch
- >Fluttershy mumbles incoherently into the couch and lays in place
- >You see her small thighs lightly working that throw pillow
- >It will have to be disposed of in the morning
- >You head to bed and bolt your door
- >Flopping onto your back, you can't ignore this throbbing erection
- >You contemplate having a good session with yourself until your mind turns to mares
- >Three ripe, young fillies... all battling for your attention
- >One is not but 20 feet from you right this moment and, from the sound of squeaking, she is not falling asleep soon
- >You calm the thoughts of juicy filly flanks and get comfortable
- >You idly stroke your member, basking in the length and feeling each vein as your fingers pass over it
- >The stench of Fluttershy is intoxicating now
- >How did you not notice it before tonight?
- >Everything seems so... colourful tonight
- >You hop to your feet, member in hand, and waddle to the window
- >The moon seems strangely dark tonight
- >While you puzzle, you hear your bed creek
- >You spin around to see Fluttershy laying her body across a pillow
- F: Anon... I just couldn't sleep. What do you got there?
- >She peers at your hand casually sliding on your hot rod
- >You turn quickly to try and hide
- A: H-how'd you get in here?!
- >You see the door is open, you swear you bolted the door!
- F: Oh, come now. You enjoyed it... didn't you? The way you were feeling up my flank?
- >Your heart is pounding now
- F: The real magic happens a little further to the left
- >Fluttershy spreads her legs and exposes her plump sex
- >Those velvety black folds catch your eye and your manhood throbs with a growing need
- F: Don't make me beg for it... I've done that for so long. Won't you just make me an honest mare?
- >You take a deep breath, but your hand won't be moved from its task
- A: F-F-Flutter...
- F: Shh... only friendship now
- >Fluttershy flexes her thighs like a scissor once
- >This kills the morality
- >Before any rational part of your mind can even begin to interrupt, you are upon that yellow minx
- F: Oh~, look at that spirit
- >You don't say a word, now is the time for shameful rutting
- >You lift her hindlegs easily into the air and taste her juicy body
- >Her warmth spreads through your lips and engulfs you
- F: Oh~! Yes!
- >Your sharp teeth tease her softest parts and your tongue shows her why they never leave you
- >You break away from her tantalizing snatch and flip her onto her belly
- >Fluttershy looks dazed for just a moment
- >The sudden pressure of your throbbing body against her quivering loins brings a smile to her face
- F: Make me your pony. Ride me like you've dreamed about
- >Fluttershy is really verbal when she's horny
- >With restraint all but a memory, you sink into her silken depths
- >The pounding in your chest is matching the pounding Fluttershy's flank is taking
- >The yellow mare moans and rocks with you
- F: Oh, oh, yes! It's everything we've dreamed of!
- >Your mind snaps to it at once
- A: Wh-what do you mean, "we"?
- >Fluttershy looks at you fearfully
- F: I mean, us, together? I was dreaming of it...
- >She's too coherent suddenly, even though you're rocking her flank like you rock the house
- F: Don't worry, Anon, I love you. Just come in me...
- >You're hips slow down as your mind rages
- A: FlutterStutter would never talk that lewdly
- >You stop completely
- >This analogue Fluttershy looks increasingly worried as you speak
- A: Something is wrong... I know I locked that door... you don't even smell like honey-suckles... you smell like... blueberries?
- >You pull out with a slicking sound and your maleness lays limp
- A: Who are you and what did you do with Fluttershy!?
- >Fakershy flies up a bit and seems to grow in size
- >She lets go a deep laugh and her voice changes
- >Before you sits the Princess of the Night, Luna
- A: The hell?
- L: Here we are just taking advantage of a wet dream and you go and overanalyze it! The immersion is ruined and -we- didn't even feel the sweet release we craved!
- A: Wait... this is just a dream?
- L: Now that you know... we can't let you leave here unscathed
- >Luna approaches you menacingly and licks her lips
- A: No! Noooo!
- >Fade to black
- >You awake to a golden sunrise and the sound of birds singing
- >You had the most terrible nightmare that Luna had infiltrated your dream and used you for hours
- >You even remember her rough blowjob and how she bit your shoulder when she came
- >Death would be awaiting you had she drained that much body fluid in one evening
- >You roll out of bed and into the kitchen area
- F: Oh, good morning, Anon... how did you sleep?
- A: Awful, I'm aching everywhere
- >You pass Fluttershy on your way to get some apple juice
- F: Oh my! Anon, who did that to you?
- A: Did what to who now?
- >Fluttershy holds a mirror to your back so you can see
- >You have a row of neat points near your neck and two large, hoof-shaped bruises on either shoulder
- A: Flutters... I think they just stepped up the game...
- >You look physically shaken
- >Unbeknownst to Anon, in a castle high in the mountains of Canterlot...
- >Be Celestia
- C: Luna, full report of last nights reconnaissance
- >Luna salutes you, the Princess of the Sun, before beginning
- L: Subject was found and his dreams were invaded. We have discovered that subject is -not- staging a coup with any of our known enemies nor does the subject seem to have any information on new enemies yet seen
- C: Excellent. Good work, my sister! However, I am... confused about this part in the report... what does it mean by, "Seven by him, three simultaneously and one premature?"
- >Luna smiles with practiced grace
- L: Subjects attempts to resist interrogation and/or subjects attempt attacks on my being
- >You look upon your sister with high esteem
- C: We are fortunate to see you back without noticeable damage
- L: My sister, we are trained in many forms of combat for just such a purpose
- C: Do you believe the subject, this... Anonymous... must be evaluate further?
- >Luna grins from ear to ear
- L: My sister... we have never seen such a labyrinthine mind as his. We feel that we shall be visiting Anonymous very soon to uncover what secrets he might still be harboring
- C: Sister, you do our kingdom a great service
- >You dismiss Luna
- >If only there was more you could do to honour her proud name
- >You are pleased with how she maintains her post
- >May Father Time be gentle and may Mother Galaxy always hold your form in the sky
- >You finish reading the written report and come upon one last annotation you do not understand
- >It reads simply as
- >Fucking Fluttershy
- ------------------------------------------------------------------------------
- >Eve of the Anniversary of Anon's Arrival in Equestria
- >Be Anon
- >Today is a special day for you so you take great care in the way you shower and shave
- >You sing a melodious opera tune in the shower
- >The door creaks open and you stop quickly
- F: Um, Anon? I was wondering if you had any shampoo in here?
- A: FlufferShed, I thought we talk about you walking in on me while showering?
- >You try to sound angry
- F: Oh, we did and I respect your space, however, this is not walking in on you. I am just talking through the small opening in the door
- A: Fine... one moment. Do -not- try to open the door any further. I will hand you the soap
- F: Thank you, Anon. You're so kind
- >You step out of the shower with bubbles in your hair
- >Carefully... carefully creep to the door...
- >The door bursts open as a white rabbit rushes in
- >The cool air causes your dangling and exposed parts to take cover
- F: Oh, Anon! I am so sorry. He just wants to fluff his tail so badly
- >Angel Bunny snatches the shampoo from you
- >You catch Fluttershy peaking at your exposed body
- F: I didn't know you had a scar -there-, Anon
- >She blushes as you slam the door in her face
- >Fluttershy is a clever devil sometimes...
- >You finish the routine and suit up
- >Today just has to be good
- >Pinkie is going to throw you a party to celebrate whatever year this is for you in Equestria
- >Can't argue with free cupcakes
- >Pinkie's always been a good friend to you as well
- >No attempted rape, attempts on your life... nope, not Pinkie Pie!
- >She just loves cooking and spending time with friends
- >You do worry that Rainbow Dash is going to be there
- >As long as there is no alcohol, you're sure you'll be fine
- F: Oh, Anon... um, you look great!
- >You straighten your tie
- A: Thank you, Flutters. I like the way you did you mane today
- >She blushes furiously
- F: Oh, it's just a little something Rarity suggested. It doesn't make me draw too much attention, does it?
- A: I am sure they'd look no matter what you were wearing... or not wearing... whatever
- >You step out of your home with Fluttershy behind you
- >Since her change of heart, you feel very comfortable with her
- >She will occasional try to harass you, but it's been much gentler
- >You arrive at Applejack's barn
- >Lavishly decorated for a barn house today
- >You are glad Applejack suggested using her place for the party
- >Nothing felt safer than being with the apple-scented mare
- >You've grown extremely attached to her in the last few weeks
- AJ: Well, howdy there, Anonymous!
- A: Applejack, so nice to see you!
- >You hug her tightly
- AJ: Pinkie did a bang-up job on the dec'eratin'. Just ya wait 'til ya see what Ah made fer dessert
- >Applejack leans in closer
- AJ: Ah even got'cha a lil' -gift-. A'course... ya don't have ta' wear it
- >She winks and pats your rump
- >This dirty flirt, man!
- >You smile and stroke her mane quickly
- >Pinkie comes bouncing by with balloons tied to her hind-legs
- PP: Anon~! Happy Anniversary! Can you believe it's already been a whole, long year since we did this? I was just saying to Gummy yesterday that we should have a party for you again and he agreed and we spent all night picking out the perfect decorations! Can you believe Gummy thought you were into plaid ribbons? Silly gator! Everyp0ny knows Anon likes green streamers!
- A: Thank you, Pinkie. That's really nice you remembered
- PP: I'd do it for any good friend and you, Anon, are one of the best friends I have!
- >You hear another voice perk up
- R: Plaid? Oh no, no, no! Dreadful on Anon. He looks best in dark blues and black
- >The marshmallow pony speaks freely of you
- R: Anonymous, why haven't you come by my boutique in so long? I have been without a challenge forever now!
- >She casts her foreleg over her brow
- R: Human clothing is truly living art! You shouldn't keep it all to yourself, darling
- >You think back to the last time you went to get something tailored at Rarity's place
- >She left you in nothing save for your boxer shorts for hours while measuring you with a disturbing closeness
- >You look at her knowingly
- >She chuckles nervously
- R: If it is about that seam incident, well, I had to measure your legs a few times to make sure it was perfect
- A: Yes, and the fondling?
- R: We~ll~, you honestly can't think I -meant- to grab your manhood. I just had to get an accurate seam!
- A: Yes... what of the part where you didn't let go and kind of stared off into space while giggling?
- R: I simply -don't- know what you mean. It's not like I was sizing you up like you were some piece of -hot meat-. I would never do that to a friend
- >Rarity flips her mane and bats her eyes
- R: Besides, I am a lady. Any -stallion- could see how prim and proper I was and what an excellent bedfellow I would make. Wouldn't you agree?
- >You find this conversation leading into dangerous territory
- >You excuse yourself for punch
- >The good thing about Rarity is she is generally a gifted speaker and not an action-mare
- >You believe she would want you to make the first move
- >It would be easy to deny anything on her part if you were caught
- >You shake these crazy notions from you head and proceed to enjoy the festivities
- PP: Wooh~! Party's on!
- >Pinkie does a ridiculous, if not adorable, dance move from one end of the barn to the other
- >You take a cup of punch and swig it quickly
- >Having spent so much time eating this saccharine fare, you've built up a tolerance for Pinkie's punch
- >It reminded you of Cool-Aid... assuming you put in three times more sugar and half as much water
- >You catch a blur of colour from the corner of your eye
- >Rainbow Dash speeds over to the punch with her usual disregard
- RD: Oh, Anon, you made the party!
- A: I would hope so. Pinkie did set it up for me
- RD: Oh, well, yeah! But, you know how busy life can be sometimes?
- >You nod to humour the blue blaze
- A: Did you... want some punch?
- RD: Nah, thanks. Too sweet for me. Don't worry, though, because I got a few ciders from AJ earlier. Cold, crisp cider... if you want one?
- >You do enjoy Applejack's moonshine, but drinking with Dash has proved hazardous to your health
- A: Eh, maybe later. Too early for me to be sloshing around
- >Rainbow leans against the table
- RD: Yeah, that's cool... sobriety is pretty cool...
- >You almost laugh at how poorly Rainbow plays it off
- >You save face and go to see Applejack again
- >Someone calls out to you before you get too far
- TS: Anon! Happy Anniversary!
- >It's Twilight Sparkle... the most dangerous pony in Equestria
- >You wave halfheartedly
- TS: I am glad I came today and found you! Now, I know the last time you agreed to help me study humans, it kind of ended with you in the hospital
- A: Twilight... I told you fire burns humans. I told you ice can also kill us. Why did you send me into space?
- TS: You didn't tell me how a human being reacts in a vacuum
- A: Firstly, you didn't ask. Second, the same way all living, breathing things react while suffocating!
- TS: But, you lasted much longer than I calculated before blacking out! Isn't that something special?
- >You sigh heavily and rub your temples
- A: So... Twily... what can I help you with?
- TS: Oh, this is an easy one and very relative to the topic of today. I was wondering if you would share a few words about your anniversary?
- A: You are not going to cut me open and count the rings after, will you?
- TS: Anon, don't be so silly! I already took skin samples for carbon dating
- >You grimace mostly because you can't remember this event
- A: Well, if it's -that- easy, I will help you
- >Twilight taps her hooves together with excitement before brandishing a quill and notepad
- TS: OK, first and foremost, how many anniversaries have we celebrated?
- >You can't think of an answer having stopped counting long ago
- >Pinkie comes stumbling by with a blindfold on and a stick in her mouth
- PP: We'f celebraided fwhor to dade!
- >She walks off to beat a piñata to death
- >Why do ponies even know what a piñata is?
- >Maybe there's a whole Spanish side of Equestria you never visited
- >No time to think about tacos though
- TS: Alright, next question... based on thorough examinations and carbon dating, I come to the conclusion that you do not have a cutie mark despite being well over the usual age for developed colts. Is that common in humans?
- A: Humans never get cutie marks. We don't really specialize in any singular thing
- TS: Poor creatures, moving on! How many times a day do you fantasize about cupcakes?
- >You actually don't do it often... better make up some number to appease the metrics
- A: Approximately three times a day
- TS: Good, good... once per meal on the average. I would have guessed as much! But, guessing is wrong and uneducated. We should always hypothesize. Moving on...
- >You fidget a bit and pray another pony will pull you out of this unforgiving mare's clutches
- TS: ... Well, how often?
- A: I am sorry, how often what again?
- TS: How often do you consider visiting me in my library?
- A: Odd question... well, since you've tried to kill me. I would say... almost never
- TS: Oh... one moment. Let me make a note that humans do not forgive easily
- >You smile a bit
- A: Also note that we do not forget for we are legion
- >Twilight actually writes this down!
- TS: There we are... Anonymous does not forgive, he does not forget. Anonymous is a legion. Is that all correct?
- A: You bet your purple backside it is!
- >Score one for meme distribution today
- >You have a giggle unto yourself
- TS: Well, thank you, Anon. I learned a lot today! I am going to get a cupcake now. Research is hungry business
- >You run the minute she is not looking
- >Fortune smiles upon you as you meet Applejack just outside the barn
- AJ: Whoa there, pardner! The parties inside
- A: I needed some air
- >Applejack smiles at you
- AJ: Plenty a' fresh air in Sweet Apple Acres an', a'course, that delicious smell of ripe apples. Yep, livin' here sure is peaceful
- A: I don't know. Don't you ever get bored? Want to see a movie? Take a stroll down to the latest eatery?
- >Applejack thinks for a moment
- AJ: Hmm... nah! Ah got everythin' Ah could want right here! Well, almost everythin'
- A: Oh? What's missing?
- AJ: Somep0ny ta' share those cold, country nights with, if'n ya know what Ah'm sayin'?
- A: You don't have to try to be so cute. You, of all ponies, should know I spend time with you because you already won me over
- AJ: Well, shucks, maybe Ah just like hearin' ya admit it?
- >You smirk and pet her mane and back
- AJ: Ah've been thinkin' though...
- A: Uh-oh...
- AJ: Oh, hush, you! Ah've thought 'bout it for a while now... do ya' find me pretty? Like... like... attractive an' all?
- A: This has been a long, strange trip. I've changed the meaning of a lot of words in the last few years. I'd have to call you, "gorgeous" these days. Even on Earth, I was a sucker for blondes anyways
- >You see AJ blush slightly and remove her hat
- AJ: So, ya' ain't really apposed ta' the idea of knockin' hooves with me?
- A: I can't say I wouldn't like to. I've thought about taking our dates a little further. We've been kissing for ages now. It is kind of different without hands though
- AJ: What makes hands so special?
- A: Well, in humans, we can fool around pretty early without actually going overboard. hands are perfect for squeezing and pulling... yanking... touching... you get the idea? We don't have to just get straight to the rough play until we are really committed... or drunk
- >Applejack ponders this for a while
- AJ: Ah see yer point... gee, never thought of how forward us pony-folk are. Oh, speakin' of which, Ah wanted to give ya' this
- >AJ takes out a finely tailored belt
- >Its made of some dark leather material that feels slightly warm and has a gold plate on one side of it
- A: It's beautiful. Thank you so much
- AJ: Nothin' but the best! Ah had it engraved with our initials... a little something ta' think'a me by
- >As if you didn't think about her sweet memory every moment you were apart
- A: Do you... do you want to head back to the party?
- AJ: Ah dunno... what if we don't?
- A: I think Pinkie would miss us both
- AJ: Or we might give'er a reason ta' throw another party?
- >Applejack leans in close and rests her hoof on your chest
- A: Pinkie... does like to throw parties...
- AJ: An' she loves ta' see her friends smile...
- >You and Applejack snap together
- >Wrapping around each other, you kiss deeply
- >You pull your faces apart long enough to stare hungrily into each other's eyes
- AJ: Upstairs?
- A: Upstairs
- >You both slip away as the sun fades
- >The music is blaring in the barn and you think you're safe enough to vacate
- >Applejack loses her hat somewhere on the stairs
- >A pile of clothes from you takes up most of the floor space
- AJ: Ah just gotta warn ya', this bed's a tattle-tale
- >You don't even understand what that means
- >These pants are just trying to make you rip them off at this point
- >Finally slipping into something much more naked, you lay on Applejack's bed
- >It squeaks a bit as you rest your weight
- >Oh, now you get it, hihihi... back to lusty thoughts
- AJ: Ah never seen all'a ya' before, Anon. Ah got ta' say, mighty impressed
- >You flex
- A: Squats and oats, my dear
- AJ: Now stop horsin' around an' rut me, stud
- >God, does this girl know how to tell you like it is!
- >You glide across the floor to your waiting mare
- >You hold her tightly in your arms and feel her heart beat in time with your own
- >She leaves little kisses across your neck and to your lips
- A: Notre amour est un amour qui va percer les cieux!
- >You grab her by her flank and kiss her passionately
- >You break the kiss out of nothing less then the need for breath
- AJ: Oh, sugarcube, speak fancy ta' me!
- >You decide against revealing your full power and continue in English
- >You work your mouth down her neck and to her belly, kissing everything in between
- >Heading south, as wicked tongues are wont to do, you come across a pert breast
- >You are both confused and exhilarated, so you quickly take her in your mouth
- >You suckle like a foal and are rewarded with a symphony of grunts and moans
- AJ: Ah~, Anon!
- >You gnaw lightly at her teat
- AJ: Don't leave marks where anyp0ny's gonna see
- >You stop for just a moment to speak
- A: Mmm, what if I want them to see?
- >You cackle devilishly for a moment before something behind you catches your attention
- >In all the excitement, you did not hear Rainbow Dash and Twilight come into the room
- >The way they are staring makes you think that they saw a bit more as well
- A: Nope, not a cancerous lump... everything checks out here!
- >You nod and narrow your eyes professionally
- >AJ looks up from her stupor with wide eyes
- >She rolls to one side to cover up, you suppose?
- AJ: Dash! Twi! What're ya'll doin' sneakin' around like that?
- RD: I can't believe what I just saw!
- TS: I can't believe Anon speaks multiple languages and I am just now learning this crucial information! Ugh, half of my data is useless now!
- >Everyone looks at Twilight
- >Seriously, what is wrong with this mare?
- A: This is none of your business, Dash. You too, Twilight!
- >Twilight is not listening while writing a note to someone
- RD: You were just going to do -that- with her like it's no big deal? I had to work hard to get -that-!
- A: You tried to rape me while drunk. You should feel honoured I didn't circumcise you on the spot!
- >You bare you fangs like a dog to punctuate the point
- RD: Look, you know what? Fine! I don't even care! You're not even worth the effort anyways! All I was doing was trying to find you so Pinkie could cut the cake. Jeez, you are so ungrateful!
- >Oh, well, that was considerate
- >You look to Applejack as she tries to hide her trickling shame
- A: Um... so... cake?
- AJ: Y-yeah, Ah'll be right down
- >You pick the pieces of your clothing up and get dressed quickly while Twilight takes notes
- >Never have you been so ultimately cock-blocked
- >C'est la vie
- >Making it back to the party, your pony friends and sworn pony enemies gather around to cut into the magnificent cake
- PP: Anon! You made it!
- >Pinkie giggles and holds her cake knife above the table
- PP: Happy Falling-Out-of-the-Sky-and-Landing-On-Mayor-Mare-Day! Oh, boy, that's a mouthful!
- >Oh, yeah, now you remember that day better
- >She was fine after a short stay in the hospital
- >You weren't even hanged like you were originally told would happen
- >Pinkie pops a party-favor over the crowd
- >The cake is cut and devoured
- A: Ah... Pinkie. You make the best cakes
- >You give Pinkie Pie a hug as the night winds down
- >You exit the barn and look for Applejack
- >You spy her sitting on the hill were you first really began getting to know each other
- >It's a short trip to that magical spot
- A: Applejack! How is everything?
- AJ: Oh, hey! Sorry 'bout earlier
- A: Hmm? What's to be sorry about?
- AJ: Ah know Ah was comin' on strong there... Ah should'a been careful with everyp0ny around
- >Applejack hangs her head a bit
- >You pull her in to your chest
- A: Oh, Applejack. It's takes two to get caught being fooly-cooly like that. Besides, I think you broke that last little bit of me that didn't just take your flank and make you mine
- >You hear a small giggle from AJ
- A: I think I did learn a very important lesson though
- >You clear your throat for a moment and Applejack looks at you in awe
- A: Dear Princess Celestia, today I learned that Applejack makes the cutest sounds when you bite her nipples. Your only human resident, Anonymous
- AJ: Oh, you varmint... Ah got half a mind to bite yours an' see how ya' react!
- >AJ lightly pins you
- A: What's the other half saying?
- AJ: It says, "Ya shouldn't bite Anon... ya should bury him in yer flanks"
- A: Well now, I can't lose!
- >You both laugh and you hold each other warmly
- >Not far from you two
- >Be Fluttershy
- F: No, he was doing what? Eep!
- >You cover your mouth with your hooves as Rainbow Dash tells you the story
- RD: Oh yesh... they were -all- over each other. That'sh the thanksh we get for being his friend!
- >Rainbow Dash hiccups into her cup
- F: Well, Anon is a good person. He deserves a good mare that he loves and who loves him back
- RD: Shure, if you're -that- gullible. Don't you live with him now? You probably do all kindsh'a nice thingsh for 'im... hash he even sucked on you once? Shome "shtallion"
- >You hold Rainbow Dash up
- >You hate seeing her like this and just want her to get home safely
- RD: We should... we should get Anon fer ush! Yeah! We should tie him up... and... and make him put hish -dick- in ush!
- >You blush at Rainbow's vulgar language
- RD: Come on, Fluttzer... Fluffer... you! We should get him tonight when he'sh shleepin'... just tie him to hish bed... and -fuck'em- like we don't even care!
- F: Dashie, you should lay down. Come on, I'll take you home
- RD: Shee? You're a good friend! If you had a hot, stallion cock, I'd let you put it in me 'cause that'sh the magic of... friendshi-... friendship!
- >Rainbow can be so lewd
- >Golly... it's just making your little marehood so twitchy
- >You need to get her home before you start getting your own lewd ideas...
- >... That is, if Anon's OK with it
- RD: That'sh why we're best friendsh, Shutterfly. 'Cause... 'cause we care about everyp0ny. Anon can keep his lil' human prick... who needsh coltsh anyway! You know what? We should, we should!
- F: We should do what, Dash?
- RD: Fucking, Fluttershy!
- ------------------------------------------------------------------------------
- >Night as We Shout Our Love From the Rooftops in Equestria
- >Be Anon
- >You wake as sunshine illuminates your small home
- >You are laying on your side in the nude
- >Something warm is nestled closely to your body
- >You look down to see Applejack snoozing peacefully
- >So it wasn't just a dream?
- >You smile widely and remember all the wild things you managed to do in one night
- >You slowly move away from her and let her body rest on a pillow
- >A soreness radiates from you hips and your legs pop and crack as you step down
- >This must be what they mean when they say, "Love hurts"
- >Unbolting your door, you step into the cool living room
- >You glance over to the couch
- >Its clean appearance alerts you that Fluttershy didn't sleep over last night
- >You dare to question why she would not be here today
- >With a shrug, you go take an amazing piss
- >Your leg shakes and you snort like a horse from the relief
- A: I better say something here before we end up with a wall of green
- >Now that you saved the eyes of everyone at home, you quickly shave and shower
- >By the time you step out, Applejack is awake and rubbing last night's workout from her legs
- AJ: Mornin', Anon. Ah didn't think ya' be up so soon
- >You stand by her with just a towel around your waist
- A: I could say the same for you. My legs are burning and my hips feel like I was run down by a tractor
- AJ: Ah like ta' think'a mahself as a semi
- >You stop and laugh
- A: What do you feel like having for breakfast?
- >Applejack looks around your small kitchen for a moment
- >She suddenly whips your towel off and nuzzles against you maleness
- AJ: Mmm, Ah could go fer a juicy snack this mornin'
- >You just cleaned that! Now it's going to get dirty and you'll have to clean it again!
- >Wait... what if you could do both?
- >Anon, you genius!
- A: Hmm, bathtub?
- AJ: Mmm, bathtub
- >You set up a warm bath and slide in first
- >AJ climbs in and lays against your body
- >Her fur puffs slightly as you run your hands through her body
- AJ: Make sure ya' git behind mah ears
- >She winks and rubs your crotch with a hoof
- >You scratch at her wet mane and bring her close to you
- >She smells so good today as if something changed since your little encounter
- >Your hands work their way to her nether lips and you rub them with handfuls of water
- AJ: Oh, yeah... clean all that mess ya' made
- >You smirk and take one of her ears into your mouth
- >She gasps a little, but doesn't pull away
- >Your tongue runs along her tall ear and tickles the lining
- >You feel her back side trying to suck your fingers in while you do so
- AJ: Oh~, gettin' creative?
- >She pulls her head up so she is leveled with your mouth
- AJ: Ah know better places fer that tongue'a yours
- >You smile and wonder which hole she'll pick
- >Her eyes capture your attention as her muzzle draws near
- >She plants a deep, passionate kiss on you
- >You try to maintain your control, but slide a finger into your little pony all the same
- >Her moan rings into your mouth and vibrates your teeth
- >She pulls apart and her tongue hangs to one side
- AJ: Ooh~, another...
- >She leans her front half onto your chest
- >You oblige with not one, but two more fingers
- >The feeling of her sex sucking and pulling at your finger tips feels soothing
- >Applejack's head lays on your should and her moaning increases
- >(Fingering intensifies)
- AJ: Sugarcube... Ah love yew... so much
- >You love seeing your mare this happy
- >Your middle finger probes the fleshy, solid section just inside Applejack
- >She coos and forces your fingers in further
- >Jackpot!
- >You give a few more solid strokes to her and feel the tightening of her body
- A: Come on... I want to feel you really let this one go
- AJ: An~on... aah~!
- >Your fingers roll about inside her
- >In no time at all, you feel Applejack's body convulse on you and your fingers can barely move
- >Hot, slick wetness forces its way around your hand and out of your beautiful mare
- >Applejack moans hard and you see her eyes roll happily
- A: That's a good girl... just let it all out~!
- >You give her flank a squeeze with your free hand
- >A delightful noise pushes its way out of Applejack's throat as your hand is squeezed tighter
- >You've come to adore the feeling of a mare's flank
- >It wasn't so different than a thick woman back on Earth, you told yourself excessively
- >You dreamed of being buried beneath Applejack's muscular, orange flank and forced to drink maregasm after sloppy maregasm
- >Jeez, thinking like this is getting you well past excited
- AJ: Oh... feels like -somep0ny- needs attention
- A: Hehe... maybe we should get out of the tub though? I think I am starting to prune...
- AJ: Did'ya know that Ah'm the record holder fer apple bobbin'?
- >Well, that certainly was random
- >What could that have to do with-
- >Applejack darts her head under the water and takes you in her mouth
- A: Oh... apple bobbing. I understand everything now...
- >You feel Applejack's tongue coil about your member
- >It slides up and down without her muzzle actually moving
- >This girl's mouth is going to kill you at this pace
- >You moan and hump as that broad tongue threatens to squeeze the life from you
- >A hoof presses hard on your hips to hold you steady
- >You desperately want to rock into her muzzle, but she probably needs to concentrate... or breathe...
- >Her mouth frees you from its vice as she lifts her head from out of the water
- AJ: Ah... hah... whadda ya' think?
- >She gasps for air for a bit with a smile
- A: I think I am going to need to make a deposit in the bank of Applejack
- >She smirks at you and quickly climbs from the tub
- >She shakes herself like a dog and soaks most of your bathroom
- >Your erection says that the mess is fine and can be cleaned later
- >You climb out next as Applejack poses
- AJ: Come on, Anon! Make me yer mare!
- >Bad horse!
- >You pounce Applejack's orange rump and ride her like you stole her
- >You get a little malicious and lift her hindquarters into the air
- >She tries to maintain balance on her front hooves, but to no avail
- >You rut your lover with every ounce of energy you can call upon
- >Her marehood oozes on your stiffness with a light yellow glaze
- >This is new
- >You hear Applejack losing her mind as she moans with a deep, throaty echo
- >You must have hit a sweet spot to get this kind of reaction
- >No time for anatomy lessons, however
- >Your legs tense and you unload like a hydrant
- >This is the best orgasm to date without question
- >You two lay on the floor, joined at the hip
- AJ: Ahh... Oh... Celestia! So good... Anon...
- >Everything smells like apples
- >The floor, you, your maleness, the air... all of it
- >You bask in the afterglow of this shattering orgasm for a while longer before you absolutely have to move
- >Some time later, you are clean (for real this time) and dressed
- >You come into the kitchen to see Applejack cooking
- A: Oh, lovely. What's for breakfast?
- AJ: Lunch
- A: Oh... what's for lunch?
- AJ: Makin' some apple fritters
- >Your stomach growls in anticipation
- >You love Applejack's cooking
- >♫Knock, knock, knockin' on Anon's~ do~or!♫
- >You open the door to see the once absent Fluttershy
- A: Hello, Flutters! How are you today? Care to come in for some apple fritters?
- >You smile widely to see your friend
- >Fluttershy sniffs the air for a moment and then looks up at you
- >Her eyes are misty and wide
- A: Is everything alright?
- >You kneel down to be face to face with Fluttershy
- F: Oh, everything is fine... I... I see you're happy with Applejack
- >Oh bullocks! You slowly remember what Fluttershy explained to you in the second chapter!
- >Does she smell Applejack on you? You don't know if this is considered offensive
- A: Fluttershy... I just want you to know that you are a great friend to me. You've been extremely kind for the last few weeks. Nothing can change that
- >Fluttershy hides her face in her mane
- F: Oh, I believe you, Anon... It's just... I... I...
- >Fluttershy cries softly into her mane
- A: Flutter... please...
- >You go to hug her
- >She flinches
- >The very notion that Fluttershy would pull away wounds your spirit
- F: I... I really did try, Anon. I thought... I thought we were getting closer...
- >You attempt to speak to her
- >She turns and runs off
- >Tears stain the ground as she gallops away
- >Your blatant friend-zoning has upset Fluttershy
- >You walk back into your house with a heavy heart
- >Even the smell of scrumptious apple fritters pervading the air cannot stave off the pain
- AJ: Who's here, Anon?
- A: Oh... no one wanting to stay
- AJ: Did'ya tell 'em Ah was makin' fritters?
- A: Yes, of course. I did the "neighborly" thing
- >AJ looks up at you and sees your distress
- AJ: Wait a tick... who was at the door?
- A: Fluttershy...
- AJ: Oh mah stars... did she try ta' hurt ya?
- A: No... nothing like that. She smelled -you- on -me-. I think I broke a pony's heart just now
- >Applejack looks at you and smiles reluctantly
- AJ: Well, sugarcube, it's not like ya' wanted ta' run to Fluttershy. Ah'd'a figured you'd'a just bed her an' make her a proper mare. Ya' know, if ya' wanted to?
- >You nod as her words ring with truth
- A: Still, I feel bad seeing her cry. I don't want anyone to cry about me
- >Applejack stirs a fritter lightly
- AJ: She'll be alright after a day or two... Fluttershy is all 'bout kindness. She'll see this is what ya' wanted
- >You look at your beautiful mare-friend as she cooks for you
- >You love this pony, you know you do!
- >There is no doubt in your head that you would want any other pony in all of Equestria
- >Then why does it hurt you to actually be rid of Fluttershy?
- >You feel the feel of which all feels are built upon
- >In a sense, you have become that feel
- A: You're probably right, Applejack...
- >She looks out of the corner of her eye to you
- AJ: Ah'd never steer ya' wrong... but, if'n ya' want... lets go take some'a these fritters over ta' our good friend. What'a'ya say?
- >You smile at Applejack
- >Sometimes it seems she is big sister to you
- >You aren't into incest, so you fall back on the idea of a 'voice of reason'
- >That's much better and now Freud can't interrupt you
- >Applejack packs up some apple fritters and you share one before the trip
- >The air is cool as the sun falls on a beautiful day
- >The trip to Fluttershy's cottage is fairly simple
- >You -do- notice a few mares giggle and paw their nose as you walk by
- >How do they smell sex over the baked goods?!
- >Applejack seems increasingly proud with every mare who notices
- >Finally, you arrive at Fluttershy's doorway
- >Toc, toc, toc, toc
- >The door opens to reveal the most evil creature on this world; Angel Bunny
- >He looks you over once and huffs
- AJ: Hey there, Angel! Is Fluttershy in?
- >Angel nods and lets Applejack through
- >You go to follow only to have a door rudely slammed in your face
- >That rabbit would make an excellent stew
- >It opens up momentarily as Applejack lets you in
- AJ: Fluttershy, look what we got here! Fresh apple fritters, made by yours truly
- >Applejack lets out a little chuckle
- >Fluttershy is laying across a sofa with piles of tissues around her
- >You can see she's been crying for some time
- F: Oh, thank you, Applejack. That's so nice of you to come all this way for m-m-meee~
- >More tears
- A: Fluttershy...
- >Fluttershy abruptly stops crying as you enter the room
- >Her lips quiver
- A: Fluttershy... please. Can we still be friends?
- F: I... I don't know...
- >A look of utter defeat envelopes you
- A: I... I understand, Flutters... I'll see you at home, Applejack...
- >You head for the door
- >Angel rushes past your feet and opens it with a pleased grin
- >You will get yours, you spawn of uncleanness
- >Heading down the trail from Fluttershy's, you stop by a nearby pond
- >The moon reflects gracefully in the water as the stars shine above
- >The stars are like brilliant diamonds watching the night sky with their sparkling gaze
- >No, wait... the stars are suspiciously like brilliant diamonds watching the night sky with their sparkling gaze
- >The stars seem to look to you as you walk
- >A feeling of absolute terror takes you over as the stars seem to draw closer
- A: I... am not alone...
- >You shift about
- >You want to wait for Applejack to come galloping
- >You want to hear something on this unnatural night
- >Nothing
- >You start to grow restless and look up at the sky again
- >The moon seems... vacant
- >It hangs in the sky, but it's presence is all wrong
- >The stars shift and follow your footsteps as you pace
- >A bush rustles nearby and you jump back in fright
- >Was it the wind?
- >You turn in place to try and watch your own back
- >The fear you feel at this moment is far beyond rational
- >A voice flitters on the wind
- Female Voice: Anonymous... beware...
- A: Beware of what?
- FV: Beware of... the... night...
- >My god! Batwoman is trying to contact me!
- A: Way ahead of you, strangely telling voices in my head
- >You see movement from the trees now
- >Shadows are dancing about you with an unnatural pace and are cast high with twisted guises
- >You carefully begin to walk away
- >An echo falls behind each of your own steps
- >You move a little faster towards home
- >The trip back has shaken you and you pray that Applejack will be awaiting you inside
- >You walk into your dark home
- >No pillow is overturned, no cushion is compressed
- >Applejack is either still with Fluttershy or has returned to Sweet Apple Acres
- >Well... you are alone tonight, but you feel it is not your fault
- >Why does it hurt so much then?
- A: Welcome home! My home... the one... I... have
- >You continue to talk to yourself out loud if only to dispel the silence
- A: I should prepare the tea for morning... maybe some cookies...
- >You walk into your bedroom and look upon your disheveled bed
- >A smile comes to your face as you remember how it became this way
- >It looks so large tonight
- >Surely, you haven't always slept in a such a huge bed by yourself for so long?
- A: Sleeping will probably fix everything. In fact, when I awake, I bet Fluttershy will be knocking at my door and Applejack will have baked a pie! Why, I might even go see Applejack and put in a little time on the farm for nostalgia's sake
- >You smile and dance in place
- L: I can't let you do that, star child!
- >You turn in place to see Princess Luna standing in your doorway
- A: You! Wait a minute... I am awake!
- L: We exist in reality too, monkey-brain
- >Luna scoffs and shakes her head at you
- >You suppose it was a little silly to imagine Luna wasn't a real pony
- L: As we were saying! Anonymous, we have decided that you will be further evaluated before we can declare you a non-threat!
- A: Oh come now! I have been here for years and this is the first time you bother me with this
- L: 'Tis true, however, you have now begun a chain reaction within the Elements of Harmony. Celestia and myself have perceived the shift and we have been tasked with keeping the elements pure
- A: Wait, don't tell me! I am going to have to somehow keep each pony friend I know from killing each other over jealousy for me? Right? Just nod if I am right
- >Luna laughs before becoming inexplicably serious
- L: Little star child, how simple that task would be! 'Tis not some 'game', not some 'fan-fiction'! 'Tis a serious breach to the safety and well-being of the populous of Equestria!
- A: Oh, well, when you put it -that- way
- L: No, the challenge set forth will test your very being and you shall be pushed to very edge of your limits until it threatens to shred you into the most basic components of life!
- >You think about it for a moment
- A: So... office work?
- >Luna stamps a hoof and a lightning strike fills your room
- L: You foolish creature! 'Tis a serious matter!
- >Luna snorts and grunts a moment before composing herself
- L: The task before you that we have set is for you to prove that you are not an agent of chaos and corruption. To do this, we must see to it that you are magically bound and obligated to the elements. Every element must accept you and, in turn, you must accept them
- A: OK, not bad... so how do I start this quest of mine?
- L: You must seek out the elements you are furthest from and develop a relationship with them of trust and friendship. Now rest, little creature! Tomorrow will bring trials and tribulations upon your domicile. We shall keep in touch...
- >Luna lowers her head to you and you feel the air crackling with energy
- >She releases a small blast at your chest and you feel a slight tingling sensation
- >Luna's mouth is closed as you hear her voice resound in your head
- L: The bond is complete. We will know what you know... we will see as you see... and we shall feel what you feel!
- >You quickly undo your shirt and look in the mirror
- >A blue ring sits inside a larger blue ring and you can make out six symbols circling inside the ring
- L: Each element that accepts your friendship will release a seal on your chest. The lesser the mark on your chest, the further you have distanced yourself from that element
- >You look over your chest again to see the butterfly, star and lightning bolt are smallest while the diamond and balloon are moderate and the apple is large
- >You have this terrible craving for ice-cream right now though
- >Luna looks at you and you narrow your eyes in defiance
- L: Oh, we do apologize. The bounding spell will also make you feel as we feel and we feel hungry as of now!
- A: Well... I suppose... good night?
- L: Yes! It will be a good night for Doughnut Joe will be open late this evening and so will the adjacent ice-cream parlor!
- >Your stomach growls
- >Luna, pls... stahp...
- L: Fare-thee-well, star child! Do not fear the lustrous moon!
- >With a flash of lightning, Luna is gone
- >The smell of ozone fills your room
- >This is going to be simple enough
- >It's not like you are in any real danger and the ponies are pretty easy to get along with while not trying to molest you
- L: Be wary of the average mare's libido
- >What? Stay out of my thoughts!
- L: You will be let alone when we see fit, Anonymous!
- >Damn it! Fine... I am going to sleep...
- L: Take care, Anon, in the land of dreams. As we look over your brooding thoughts, we fear you shall not sleep so well
- >Do I have to put up with this until I befriend everyone?
- L: We believe this will be the most useful and accurate way to make sure you are indeed true of word and heart. So, yes... yes, you do
- >Well, stay out of my mind when I'm using it
- L: We may do so unless you are dealing with the elements
- >You toss and cover your head with a pillow despite the futility of it all
- L: Now do get some rest... one moment, what is this thought we see? Oh, you seem to recall our encounter in detail. Lets us help you to prepare for tomorrow's journey
- >Your thought of Luna molesting you changes shape in your mind
- >With a swift motion and a rough grunt, Luna changes her memory's shape so that you are
- >Fucking Fluttershy
- ------------------------------------------------------------------------------
- >Day Kind Souls and Kinder Foals
- >Be Anon the Callous
- >You are tasked with befriending all the elements and having them, in turn, accept your friendship
- >From the marks on your chest, courtesy of Princess Luna, and the events of yesterday, you will start your friendship quest with Fluttershy
- >You never thought you'd be chasing her
- >How the mighty do fall!
- >You have not seen Applejack this morning
- >She is probably on her farm and actually doing productive work
- >You relinquish the thoughts of her for the moment and focus on the task at hand
- >You arrive at Fluttershy's cottage at the edge of the forest
- >It really is beautiful
- >Standing firm, you knock at her door
- >After a moment, it cracks open and you see the yellow face with tear stains on her fur
- F: Oh... hello, Anon...
- A: Good morning, Flutters... I, uh, I just came by to ask you...
- F: My fetish?
- >You cross your arms
- >This is serious!
- >Luna: Yes, it is!
- >Ah! You! Stay out! I am trying!
- A: Fluttershy... I came over here to apologize and try to make amends. You are such a good friend and I don't want to lose you to something petty like...
- F: Petty? You think my love for you is -petty-?
- >She hovers so as to stare eye to eye and brings her face in close
- F: You listen here, mister! I tried really hard to guess your fetish and be there for you every day! I spent so many bits that I sacrificed food for myself! And you dare tell me that I am the petty one?!
- A: Fluttershy! Don't you raise your voice with me! I came here not to belittle you, but to try and be your friend!
- F: Well... I thought about it all night. Maybe... maybe I don't need a human friend or a human lover!
- A: Flutter... shy
- >You clutch your heart and fall to your knees
- A: I... I am... wounded...
- >Fluttershy holds her hooves to her mouth and her eyes go wide
- >You roll over onto your back and lay prone
- >Fluttershy rushes to your side
- F: Anon! I... I didn't mean to!
- >You lift just your head up and smile
- A: Didn't mean what?
- >L: Oh, trickery? No, your emotions are not malicious... what are you doing?
- >Just let me work and stay out of my head!
- F: Oh, Anon, that was mean! I was just standing up for myself and you do something so silly like pretend I killed you!
- A: Did I make you smile though? Just for a moment?
- >Fluttershy looks away and pouts with a mix of anger and sadness
- F: A tiny smile to know you aren't dead... but, still, my answer still stands that I don't need a human lover or friend
- A: Can I kindly disagree with the last part?
- >You pull yourself up into a sitting position so as not to be taller than Fluttershy
- A: I know it's been difficult between us... Applejack has surprised me in the end as well. I never knew she liked me. When you and I were together, after the Dash incident, I have to admit that I felt something
- F: W-what did you feel?
- >You take Fluttershy by the chin and look into her eyes
- A: I felt happy to be around a great friend who I could trust
- >Fluttershy bites her lower lip and starts crying
- >She pulls you into her hooves and hugs you tightly
- F: Anon~n... we s-s-shouldn't be fighting! We should be fri~e~n~ds!
- >She wails into your shoulder
- >You pat her shoulder and stroke her mane
- A: There, there. I can never be mad with you. I even came by to see if I could help with your chores. I mean, you did so much at my house when you stayed over
- >Fluttershy sniffs and wipes pony snot away with her foreleg
- >Hehe, gross
- F: Do you really mean it? Do you really want to help me today?
- A: Of course
- >L: You're head says there are 11 other things you rather be doing
- >Shut it, you! I can override the need to be lazy when I want
- F: Oh, that would be nice... just you and me... working together. Like goods friends should
- A: Precisely! Just point me at the work and I will be all over it
- >Fluttershy takes you around and shows you the varies things she'll be doing
- >Feeding animals seems straightforward as does watering the plants
- >This task frees up much of Fluttershy's time and she goes indoors to work on dusting and changing beds for the animals
- >This reminds you of your first job as a child in the pet store and you hum an old tune to pass the time
- >L: Hmm, what an odd song... what is it called
- >"Whistle While You Work"... now get out, I am busy
- >Within the hour, you are finished and set out to find more ways to help
- A: Fluttershy! I finished feeding the chickens!
- >You get no answer
- >You remove your shoes before walking into the clean dwelling
- >You glide slightly on the polished wood floor
- >This feeling...
- >You glide about while searching for Fluttershy
- >L: You're enjoyment has spiked for some reason... we do not see why though
- >Ignoring the voices in your head, you skid to the kitchen
- F: Oh, Anon, I started to prepare lunch. I know you must be famished from all the work. Why don't you take your coat off?
- >Not wearing a suit in full seems taboo, but you do so anyways
- F: You know, Anon... when you first came over, I was really sure I didn't want to see you. I was so wrong and hope you can forgive me for being so loud with you
- A: Think nothing of it, FlutterShutter
- >She smiles and zips around the kitchen gather items
- A: Is there something I can do in the mean time?
- F: Oh, if you would, could you get me a salt block? I keep extra in the cellar on the top shelf. You can't miss it
- >You nod and smile
- >The cellar is a short trip behind the house and you walk into the cool darkness
- >You look over the shelves as you walk down
- >Barrels of feed line the walls, extra buckets and vials line the shelves
- >All manner of hedge trimmers and cutting instruments are hung neatly on a pegboard
- >Reaching the bottom of the steps, you notice one out of place nail pinning a metal leash to a wall
- >Now, that is rather odd
- >L: We would agree. It is unlike Fluttershy to chain animals up
- >I can't imagine what it's for
- >You shrug, retrieve a salt block and head back upstairs
- >Entering the kitchen again, you see Fluttershy has prepped two plates and cups for the two of you
- A: Well, isn't this nice? The two of us having lunch after a good day of work
- >You feel a little sore from the bending and stretching of the day
- F: I am really happy you decided to come over after all
- >You take a forkful of the salad before you and munch loudly
- >This is really good for some reason
- A: Pleasure's all mine. You really are my very best friend
- >You take another bite and savor the green, leafy vegetables
- >You can't explain why they are so delicious today
- >L: Hmm, something tastes a little different. Yes... yes... it is... some type of fertilizer...
- >You cough at Luna's thoughts
- F: Oh, would you like some more water?
- >Fluttershy smiles widely and holds the pitcher
- A: No, thank you. Just went down the wrong pipe!
- >L: Hmm, no, we don't agree with your thoughts here. We do not think she will be trying to poison you
- >Leave my mind alone!
- >L: Calm yourself, Anonymous
- >Your body feels heavy now as if you are having weights added to your legs and arms
- A: Oh, this meal was wonderful, Flutters. I should be... going...
- >Your head spins a bit as you stand up and you slide to the door way on your socks
- >L: Hmm, our balance seems off... we would suggest that we sit down for a spell
- >Maybe you are right
- A: I am going to take a seat on your couch for a moment. If that is alright with you?
- >Fluttershy nods happily
- F: Of course, Anon. My couch is your couch
- >You stumble over and fall back onto the couch
- A: My head feels... a little funny...
- F: Oh, no... maybe it's the heat? Let me help you undo your shirt
- >L: Is this was fear feels like to a human? Odd, I thought you'd have more power in this
- >Get... out... of...
- >L: Hmm, do not fall asleep. We are not having that!
- >You feel Fluttershy undo your shirt slowly and your bare chest is exposed to the air
- F: Oh, look at you. You poor thing. You're burning up. Let -momma- help
- A: F-Flutter... what happened...
- F: You look like you're coming down with something. I'll take care of you...
- >You feel Fluttershy's face get close to your chest
- >Her warm tongue caresses your bare chest and encircles a nipple
- F: Momma's here for her pets... yes, she is...
- >Fluttershy licks and gnaws at your nipple
- >You cannot move any more, but are still semiconscious
- F: Oh, your body is still so hot... so very hot... we better get those pants off
- >L: Oh, we recognize this now! It's a tranquilizing agent... we wonder how Kindness has gotten hold of such a drug though?
- >Luna... I... hate... you
- >L: We are considering helping you... let us see where this is going first
- >Fluttershy removes your pants and slides them off
- >You are now in boxers and socks only and your body feels like lead
- F: There we go. You should cool down soon with all those nasty clothes off
- >Fluttershy rubs herself slowly up to your waist
- >Her tongue plays around your naval with lewd slurping sounds
- >L: Hmm.. let us just wait a little longer...
- >You're... sick...
- F: Oh~, Anon, what is this? Are you poking momma with -that- on purpose?
- >You body managed to get an erection somehow
- >L: Yes... Kindness is truly skilled at giving
- >Luna... why... won't... you... help?
- >L: Just five more minutes
- >Fluttershy spreads the slit in your boxers and exposes your maleness to the open air
- F: Oh~, is this what you think of your -momma-? All this is for -her-?
- >I wish... she'd... stop... this...
- >L: Are you not entertained? You're mind is fighting vigorously for some reason
- >Fluttershy pushes you down with a hoof
- >You can feel her hot breath on your manhood
- >Her tongue drags you into her mouth slowly and she muzzles you lightly
- >L: Ah~! We cannot see how you would stop this
- >Apple... jack...
- >Fluttershy sucks you into her muzzle until her wet nose is brushing into your crotch
- A: Flut... Ter... Shy...
- >She removes you from her mouth to speak
- F: Oh, my little human. Don't try to speak when you are so sick. Just let momma make it all better~
- >She grins a wicked grin and goes back to her blowjob
- >Her mouth pushes you to the point of no return and you feel a weak orgasm pump through you
- >L: Ah! Oh! These drugs are nullifying so much! We cannot bear this!
- >Fluttershy milks you a few times with her mouth and swallows you entirely
- F: There we go! Oh, you must have been hurting from all that. It's good that momma could get that out of you
- >You hear a splotching noise as Fluttershy grinds into your leg
- F: Oh my, it looks like the swelling isn't going down. Momma knows a lot of remedies. Don't worry
- >Fluttershy slides up your leg, leaving a wet trail right to your crotch
- >She pushes against your maleness and forces it between her wet snatch and your belly
- >Fluttershy rubs with a little haste until your body quivers
- F: Oh, look at you! Already starting to heal. Momma's gonna make you better in no time!
- >There's a hint of sadism in her voice as she humps you harder
- F: Now, lets get that icky sickness out of you...
- >Fluttershy positions herself at the very tip of your sex and slides onto it
- >She has so much control over every part of you that it drives you a little mad
- >L: Kindness is excellent. We would never have guessed!
- >Luna... why won't you... help?
- >L: As your shadow, we would like to finish what has begun
- >But... Applejack...
- >L: ... Is not currently riding us to a glorious orgasm
- >Your kind of suck
- >Your mind is halted as you feel the Princess orgasm
- >A sweet release of pent-up frustration spills from your mind
- >Your body suddenly feels rejuvenated and you quickly regain your strength back
- >Fluttershy doesn't seem to see you move your arms as she rams herself atop of you
- F: So~ good! Oh! Fill momma! Show her you love her!
- A: You're kind of kinky, you know that?
- >L: Oh, Anon, are we really to do that to her?
- A: Yes, Luna...
- F: L-Luna?
- >You grab Fluttershy's hips and your eyes shine with blue fury
- A: I'm gonna need -both- hands for this!
- >You pile-drive Fluttershy into your body with unrelenting force
- F: No, Anon! Not... so fast~! Aah~!
- A: You wanted this, "momma". Now you'll get your fill!
- >L: A-Anon, how are you...
- >Two can force their presence
- >L: D-don't use... my magic! ooh~!
- >[Sexing intensifies]
- F: I-I'm sorry~, oh~, my little box~
- A: Here it comes, you glutton!
- >Fluttershy seems to have lost all her dominance since you've held her
- A: I bet... ah~, you're fetish is... ha... is being fucked... by your pets!
- >Her face is smeared in blush and she hides her eyes under her hooves
- >You can feel her maregasm gush onto you and you pound away
- >L: Anon... you beast~!
- >You feel Luna cum next and your abused body can't resist
- >You paint Fluttershy's inside like Picasso
- >You withdraw from her quickly and clean yourself on her cutie mark
- A: That's what you get for date-raping me. I am almost ashamed I used up a load on you
- >Fluttershy weeps lightly
- A: Here I thought we'd be friends. How can I ever trust you when you keep disregarding my feelings? I was tasked to come her and try to make amends!
- >L: Do not divulge our bargain or we shall execute you where you stand!
- >As if you could do...
- >Your chest shudders and your heart races
- >You clutch your chest
- >Hnnnnnng!
- >The pressure lets up as you fall to your knees
- A: Oh... OK...
- >You look at your chest to see that the blue ring glowed red for a moment
- >It slowly fades to blue as the pain subsides
- >Well, isn't that a neat little bit of insurance?
- >L: It is just in the off chance that you mess up so dearly that we'd have no choice but to erase you
- >I will find a way to keep you out of my head...
- F: Anon? Are you alright? You look like you're in pain...
- A: It's nothing... I am hurt more in feelings than in body. I thought we were past FlutterDome?
- F: Oh... well, I wasn't even going to do what I did. While you were in the cellar, well... I just thought how nice it would be... to... you know? You worked so hard and your smell is driving me crazy. It's kind of your fault to tease a mare like that
- A: So, like... do ponies know what unwanted sexual advancing is? Because everyone of you seems to have this need to molest me
- F: Oh, I don't want to call it -that-. It sounds so violent. I mean, you were pretty scary back there when you... oh... you filled me up with your... your...
- >Fluttershy blushes and covers her face
- F: I just can't say it... I'm so embarrassed
- >How does she go from serial rapist to coy schoolgirl like that?
- >L: 'Tis the nature of Kindness to lean sharply in one direction at a time. When she is good, she is very good. But, when she is bad, she is horrid!
- >Ugh, I hate that nursery rhyme
- A: Look, Flutters... I...
- >You stop for a moment as a cool feeling spreads along your chest
- >You look down to see the butterfly symbol grow a bit larger
- >There is no way... this makes no sense!
- F: I am sorry for taking advantage of you, Anon. Oh, but you did fill me so well. If I had a foal from this, I would be so happy
- A: I can't get you pregnant... that's biologically impossible
- >Fluttershy gets close to your leg and nuzzles you
- F: Nothing's impossible with the power of friendship
- >Fluttershy is absolutely insane...
- >L: I believe Kindness has always longed for a child. It is why she hoards animals and is a pony pleaser
- >Holy hell! Adopt! Or go fuck a stallion! Seriously!
- >L: She wants no stallion save for you, Anonymous
- F: Do you... do you think you'll need more work in the future? Like, tomorrow? I will have plenty to do
- A: StutterButt... we will not be having any more sex. Period. Done
- >She blushes
- F: Oh, Anon, I could never ask you for -that-. Why, I'd be so embarrassed that I'd simply hide from you all day. But, just to be clear... being drugged is not your fetish, right?
- >You scream in terror and run as fast as your sore legs can muster
- >She's back! The yellow menace has returned and actually got her way!
- >You are exceptionally paranoid now and proceed to Sweet Apple Acres
- >You need to see Applejack
- >About 30 minutes later, you arrive
- >Body aching, half-dressed, and smelling of sex... this seems like a bad idea now that you think about it
- >L: If Honesty loves you as you believe, it should mean naught to her
- >You see a large, red pony hauling apples and run to him
- A: Big Mac! Thank the heavens... is Applejack around?
- >Big Mac looks to you for a moment
- BM: Eeeyup
- A: Excellent, is she busy?
- BM: Hmm... nope!
- >Big Mac points a hoof toward the barn house
- >You dash to it and peak inside
- >Applejack is moving some hay around for the cows
- A: Apple... Applejack! I need to talk to you...
- >You fall to your knees in exhaustion
- >L: You should not push your body so hard. We feel your vitality is starting to fade
- >And it gets worse when you talk about it!
- AJ: Anon? What're you doing here?
- A: I had to see you... day... rough...
- >Applejack stops and looks you up and down
- AJ: Whoa, pardner! What happened to ya'?
- A: Fluttershy... drugs... old ways... I...
- >You collapse to the floor
- >The last thing you see is Applejack's face looking nervously over you before you black out
- >You are now floating weightlessly in the sky as the stars twinkle a warm welcome to you
- A: Oh no... I died?
- L: No, Anonymous. You simply fell asleep for pushing your body beyond its limits
- A: Oh... and now you will harass me in my sleep?
- L: Neigh! We have come to look over your damaged psyche
- A: This is horrible... I know you heard, saw... felt everything! Flutterstutter is back to her old ways
- L: Yes it would appear Kindness is indeed trying to rape you. However, she has grown much more loving since your little escapade
- >You check the symbols on your chest to see it is true
- A: I don't understand though
- L: What is not to understand? Kindness wants but one thing from you and that is your seed
- A: Well, that's going to be a problem. I only want to put my seed in Applejack
- >Luna laughs a moment
- L: Your memories tell us that since you've first experience sex with a mare, you have considered every other mare you cross paths with
- A: That's called, "being a guy". I -love- Applejack and can stop myself from just jumping on any willing mare who presents herself to me!
- >Luna laughs again and approaches you smoothly
- L: Is that so, star child? If we were to present our full and perfect backside to you, you would deny us the pleasure of copulation for the sake of Honesty?
- A: Yes! Firstly, your backside is far from perfect. Secondly, I love Applejack and she trusts me to be her lover!
- >Luna takes a step back and gasps lightly
- L: -You- would say such rude things to -us-? How dare you disgrace our marehood with the likes of commoners!
- >You sneer with great effect
- A: I've fucked pillows with more heart than you!
- >Luna furrows her eyes at you and you can feel her rummaging in your thoughts
- L: We see not one time you have practiced intercourse with a pillow! We see multiple occasions were you have fantasized about us!
- A: The matter stands! I love Applejack! I will bed, breed and marry that pony! I am not your plaything!
- >You suddenly grow a size and a half over Luna
- >You are not sure why, but you smile and flash your teeth at Luna
- A: This is my head and in my head, I say what goes! You would do well to leave me be and let me rest before I find a use for your tiny, fragile body!
- >You assault Luna's head with a variety of sexual acts that you yourself aren't even comfortable with
- >Luna begins to cry as you force this suffering into her and you see her gallop away with great speed
- >You feel a heaviness in your heart as she runs away
- >You are not sure if it is your own or Luna's
- >Sleep soon overcomes your mind
- >You awake to a bucket of cool water being dumped over you
- >You choke and sit up
- AJ: There we go, sugarcube! Ah think the ol' sun got to ya'!
- >You rub your face and look up at your beautiful mare friend
- A: Apples... is it really you?
- AJ: A'course! Who're ya' expecting?
- A: I just don't know anymore
- >You stand to your feet and smile warmly at Applejack
- >She rubs against your leg with her body and looks up to you
- AJ: Yew were pretty dizzy when ya' first got here. Wanna tell me what yer runnin' from?
- >You think for a moment and decided honesty is your best policy
- >No condescending remarks... you must be alone right now!
- A: To be completely honest with you... I was working with Fluttershy today to try and make some peace with her. One thing lead to another and we sort of had sex...
- AJ: Beg pardon?
- >Applejack looks quite angry
- A: I fell into her trap and ended up having sex with her
- AJ: Well... Ah can't say Ah am angry with'cha. Just tell me, promise me... you'll stay away from the other ponies if'n Ah ain't around?
- A: I really want to promise you that... I don't know if I can. I have a special request to fulfill
- AJ: From who?
- A: The Princesses... it's kind of a secret deal. I shouldn't really say too much
- >Applejack thinks for a moment and paces
- AJ: Well... Ah trust ya', Anon. Whatever it is ya' gotta do fer 'em, ya' should!
- A: Thank you for understanding...
- AJ: But, ya listen here! If'n ya' get in trouble an' Ah ain't there. You're gonna have ta' deal with it yerself!
- >You nod solemnly
- >You reach a hand out and caress Applejack's head
- >She moves in closer so you can keep at it
- A: I promise to be with you and only you soon. I will come work on the farm again hauling apple barrels!
- AJ: Shucks, that'd be mighty nice. Workin' with'choo so closely again would be a hoot. 'Specially with all those new benefits we got
- >Applejack chuckles and winks at you
- >Her advances are the first time you felt emotionally excited all day
- >How easy it is to love a lovely pony
- AJ: Day's goin' out soon. Ah was thinkin'a washin' up soon an' maybe comin' ta' visit. but'choo know what? Ah don't think Ah can scrub behind mah ears. Maybe if'n Ah had the help a' some feller with strong hands?
- >You flex your fingers around her ears and through her mane
- A: Oh! Pick me! I got strong hands!
- AJ: Ha ha! Well, help me git these last two barrels put up fer the night an' we can spend a few hours soakin' down
- >You beam and have renewed vigor
- >It takes very little time for the two of you to finish up
- >You decide to spend the night at Applejack's place
- >Applebloom is ecstatic to have 'Uncle Anon' over
- >Big Mac, on the other hand, is a little apprehensive
- >Apparently, Applejack told him all about your tumbles in the proverbially hay
- >The moon rises much slower than it usually would tonight and you can't help but feel responsible for that
- AJ: What's on yer mind, sugarcube?
- A: Events of the day
- AJ: Wanna tell me somethin'?
- A: Not really... no... it's all kind of blurry
- AJ: Well, what say you an' me go take a nice bath ta' wash away them problems?
- >You smile and nod
- >Applejack has become such a wonderful friend
- >An amazing lover
- >She just makes your spirit soar in a way it hasn't in years
- >You hop to the bathroom and find a porcelain tub
- >AJ closes the door as you turn the water on
- >You pull your shirt up and around your head before feeling a tug at your pants
- >When you clear the shirt away, you see Applejack undoing the buttons with her mouth
- >You just sit back and let her do her magic
- >Her nose grinds against your crotch and you feel her sniffing
- AJ: Oh yeah... that's Fluttershy alright. Smells like shame and loathing...
- A: Mostly my own
- >You chuckle, but Applejack doesn't return the gesture
- AJ: Better wash that off first... Celestia knows where -she's- been
- >You take the hint and slide your pants down with your boxers
- >You pose for a moment naked in front of Applejack and she blushes lightly
- >A short dip in the tub and you can feel your body relaxing already
- A: Oh yeah... I really needed this
- >Your aching muscles melt and you lay limp in the tub
- AJ: Scoot over a bit. Tub's not as big as the one in yer house
- >You do so and Applejack dips herself in slowly
- >She looks very tired from her long day of apple bucking
- AJ: Ah love a hot bath to really git that dirt outta yer hooves
- >You take the nearest hoof in your hand and rub your fingers around the underside
- >Little flakes of mud and debris are shaken loose
- >AJ smiles and lets you clear all her dirty hooves
- AJ: Now, Ah never felt so special b'fore. Usually Ah'd have ta' go to the spa jus' ta' get that kind'a treatment
- >She lets the water drain in the tub and starts refilling with clean water
- AJ: Ah feel a little bad that Ah can't really clean ya' so closely... well, not all a ya'
- >She presses her shining hooves to your chest and lays her wet body against you
- >Her mouth reaches out for a kiss and you meet her half way
- >What a wonderful feeling it is to have her lips on your own
- >You are both so lost in your kiss that you don't notice Applebloom has walked into the bathroom
- AB: Whoa! Sis and Uncle Anon! How come yew both git ta' take a bath together an' Ah don't?
- >Applejack pulls back from you quickly and you try to cover up when you can
- AJ: Applebloom! Where's yer manners, girl!? Ya' knock b'fore trottin' in to a bathroom!
- AB: Sorry, but nop0ny said ya'll were takin' a bath!
- AJ: Alrighty, Applebloom. Ya jus' clear out fer now an' Ah promise we'll take a bath tomorra'
- AB: But, why can't Ah jus' take one with ya' now?
- >Applebloom gets dangerously close to the tub
- AJ: Look here, lil' sis! Ah'm serious 'bout ya' clearin' outta here
- AB: Is Uncle Anon nekkid? Well, Ah guess ya' wouldn't wanna git yer nice clothes wet
- AJ: OK, Applebloom, we gotta dry up now so ya gotta go
- AB: What? Why?
- >Oh damn, you have something she's never seen before... mostly due to different species
- A: Applebloom... if you'd kindly remove yourself while I get dressed. I can tell you a great story before bed?
- AB: Well, Ah do like yer stories... but, what's the big deal? Everyp0ny walks around without clothes unless we're goin' to some fancy ball 'er somethin' anyways
- A: Well, as you may have notice, I am not a pony... so, there's that
- AB: Do ya' have a bad tail-cut? 'Cuz ya' know Ah wouldn't ever tell nop0ny that's why you hide yer tail
- >You smile as best you can to Applebloom
- A: That's not exactly the reason...
- >Applejack finally hops from the tub and escorts a whining Applebloom out
- >You quickly buff yourself out and pull the better half of your pants on
- >You decide to go without a shirt for now
- >Applebloom is waiting in her room as you pass by
- AB: Anon! Hey, Anon! Ain't ya' gonna tell me a story?
- >You stop and backtrack into her room
- >You did say you would after all
- A: I got a good story for today. It's a story about a fox and some grapes
- AB: Eh... not in'erested... can ya' tell me about how ya' got yer cutie mark?
- >You stop for a moment
- A: I don't have a cutie mark
- >Applebloom's head nearly spins on her shoulders
- AB: But, how?! Yer as old as mah sister! Maybe even older!
- A: It's difficult to explain, but humans don't get cutie marks. We just learn as much as we can and hope we're good at something or other
- AB: That sounds terrible... but~, since ya ain't got a cutie mark or nothin'... wanna join the Cutie Mark Crusaders?
- A: Your clubhouse? No, no... sorry, but, I'm just too old to have fun anymore
- >Applebloom lays in your lap
- AB: Well, this is sort'a bummin' me out... how 'bout ya' tell me a story from your home?
- >You stroke her little mane and speak softly
- >You recount a tale of a great summer's adventure with friends
- >She smiles and lays her head on your lap a while longer
- AB: Anon... Ah'm happy my sis found ya'... ya' make her so happy... an' ya' tell the best stories...
- >She yawns widely and stretches out
- >You tuck her into bed and pat her head once
- A: Good night, sweet princess...
- >You walk out into the hall and see Applejack standing close by
- >She eyes you over carefully and bats her lashes
- AJ: Ah see ya' got a tender spot fer mah sis... yer pretty good with foals
- A: I had enough brothers and sisters growing up to know how to handle them
- AJ: Hmm, Ah like knowin' ya' can handle yerself with a foal or two... incase we get ta' that point
- >You are about to explain the biological impossibilities of human genes crossing with pony genes and why DNA does not work like that when Applejack closes in on you for a smooch
- >Your intellect is cast aside as Applejack's thick tongue takes hold of you
- >The two of you stumble backwards through the hallway into her room and close the door
- >L: Testing... 1-2-3... 'tis your Princess speaking. Do you here us, Anon? Oh, we see... feel... that you are busy. We shall call upon you in a few minutes...
- >Luna... so you've come back?
- >L: For the mission, we assure you. Though all this horseplay has caused our body a significant workout this day. We shall, ooh~! We shall call upon you, ah~ ah~... soon! Oh~!
- >Up in a cloud somewhere in the city of Cloudsdale
- >Be Rainbow Dash the Loyal
- >You finish reading the letter Fluttershy sent you
- >You can't believe Anon came over and she got to have him!
- >It's like Anon is giving it away to every -other- pony in town
- >Are you not good enough?!
- >You check yourself over
- RD: Same slick mane
- >You run your hoof through your mane
- RD: Same strong, runner's legs
- >You stretch each leg out and pose in front of your mirror
- RD: Same sexy smile and seductive eyes
- >You lid your eyes and kiss the air
- RD: Yep, still irresistible... so, how is Anon resisting?
- >You ponder a bit and decide to see Fluttershy in the morning
- >You have to find out what Anon really likes
- >He should really like you for all the good times you had
- >There was that time you took Anon fishing... or was that Pinkie?
- >But, what about that time you and Anon had those great drinks?
- >Yeah! And you paid for most of them!
- >And you... you... you forced yourself on him that night...
- >You think harder than every before
- >Is Anon mad at you or maybe even scared since that night?
- >Could your rash actions have caused him to not want to spend any time with you?
- RD: That night was great for both of us!
- >You shake your hoof angrily at the mirror
- >You bet Anon loved every minute of eating you out
- >In fact, you're gonna make it your business to spend time with Anon tomorrow and he's gonna cum inside you like you know he wants!
- >You'll make sure that you get your taste before any more fooling around with Applejack or
- >Fucking Fluttershy!
- ------------------------------------------------------------------------------
- >Day Tangled Up in Blue in Equestria
- >Be Rainbow Dash the Loyal
- >You have plotted all night for this
- >Today, you will get Anon's attention and he will see that you are the best mare for him
- >You smile at your appearance and groom your mane carefully
- >You tumble from your home in the clouds and spread your wings into the early morning
- >Flying is first nature to you as you unfurl your wings into the wild blue yonder
- >Soaring along, you keep away from any clouds that might get in the way
- >You would hate to get on the ground covered in mist and dew
- >Anon's house appears along the ground and you push onward
- >You commit yourself to proving why you are the most awesome pegasus ever!
- >Be Anon the Oblivious
- >You wake up beside Applejack and rub your face
- >A small light shines in from a window above the bed
- >Morning has come surprisingly quickly
- >You look over to the sleeping Applejack and sigh happily
- >Her mane shines like gold in the morning light
- >You just love it when she lets it hang out... her mane, that is
- >Sneaking to the door, you peek around the corner
- >Only head exposed
- >No one is in the hallway yet and you resolve to reach the bathroom unnoticed
- >The floorboards creak under your weight and you cringe
- >Big Mac comes up from the stairwell to see you creeping along
- BM: Mornin', Anon... sleep good?
- A: Oh, hello, Big Mac... yes... I slept rather nicely
- BM: Ah'm surprised, really. Sounded like AJ was keepin' ya up from mah room
- >He narrows his eyes at you
- >Now is the time to use your incredible knowledge and excellent verbal skills to diffuse the situation
- A: Y-you too!
- >Oh, that wasn't right at all
- >You hear a familiar voice echo across space
- >L: Good morning, Anonymous
- A: Oh, not you too...
- >Big Mac looks around with surprise on his face
- BM: Wha?
- A: Not you, I meant... something or other... I need to pee
- >You race to the bathroom and close the door
- >Why don't they have a lock on anything in this place?
- >Regardless, you find the nerve to tinkle
- >What a relief that first morning pit stop is
- >L: Anon, we need to speak to you this morning
- >As if I could block you out... what is it?
- >L: We have been listening to your sleep patterns and piece the shapes of your dreams together and we feel we have been... less than hospitable to you
- >I could not agree more!
- >You finish up and wash your hands and face in the sink
- >L: We should have released your body sooner with Kindness. We see that you truly care for Honesty in a way that brings us such sentiment. The entire night you slept, our minds were at peace and a deep sensation of happiness encompassed our being
- >Good, you should be my warden if you're going to also be my executioner
- >L: That was also a bit too hard from us. We did not mean to be so... what's the word? Abrasive?
- >Heart attacks -are- rather rough for my kind... good word
- >L: We detect sarcasm and scorn. Fair enough!
- >You walk from the bathroom and down the stairs while putting your clothes on properly
- >I do have a question for you though, if you'd be so kind
- >L: No need to ask. We can feel your curiosity. Yes, the elements will bend to our will without hesitation. It is encoded into each element to be faithful to the throne
- >So... is there a possibility that I could change their loyalties?
- >L: Not in the slightest! You can cause them enough distance to inhibit their power. Celestia and us combined could still unite them, albeit against their will and their powers would be greatly reduced
- A: Hmm, interesting... well, I suppose that is reason enough to strive for friendship?
- Granny Smith: What's this 'bout 'friendship' now?
- >You snap back to reality as best you can
- A: Oh, uh, nothing! Friendship is great
- GS: Darn tootin'! Why, did Ah ever tell yer 'bout the time me an mah friends placed the ol' stick-ball? Ah was the best at hittin' the apple clear cross the field! We always used apples! That's why we called it, "Apple battin'!"
- >You nod, half listening to the ramblings of the old mare
- GS: Yew gonna buck apples today, deary?
- A: Oh, yes... yes, I would love to
- GS: Well, good fer ya'! Jus' grab some grub b'fore headin' out
- >You spy a delicious looking waffle covered in hot apple crumb and snatch it from the plate
- >Stuffing it in your mouth, you savor the wonderful flavors and the warm feeling in your stomach
- >L: We greatly enjoy the tastes you experience. 'Tis a new perspective on such familiar foods!
- >Working, no time for your voyeurism
- >L: We shall be here to answer any thought that may come to mind
- >You try your best to ignore Luna and head outside
- >Manual labor has proven to be therapeutic before
- >Working your body as hard as possible gives your mind time to sit and not think
- >You grab the first barrel you find from yesterday's harvest and carry it to the barn
- >You do this again and again until there are no immediate barrels left
- >It must be a little past sunrise now as you see Applejack gallop from her home
- AJ: Anon! Ah was wonderin' where ya' went
- A: Just working this morning. I haven't done this in a so long
- AJ: Well, shucks, ya' beat us all out here today
- >Big Mac steps from the barn with a yawn and smacks his lips
- >You see him head to a large wagon and hitch himself
- A: Wanted to give back to you after all the great things you did while staying with me
- AJ: Aww, ain't nothin' much
- >She playfully nudges your side and you stumble a bit
- A: Horsing around this early? Hihi
- >You smile widely and grab an empty barrel
- AJ: Why don't we fill up some together?
- >You nod and proceed to a heavy tree
- >Applejack rears up and kicks from her hips
- >The tree shakes hard and apples pour down on you
- >A reflex over takes you and you manage to catch nearly every apple
- >You bring this back and grab another empty barrel
- >An hour or so passes before you start to slow a bit
- AJ: Sun's gettin' high. We should grab a bite fer lunch
- >You never deny good food and a cup of delicious cider
- A: I'll meet you in the kitchen after I drop this barrel off to Big Mac
- >Applejack nods and trots lightly towards the house
- >You heft the barrel to your side and begin crossing the acreage
- >Be Rainbow Dash hiding on a nearby cloud
- >After searching for Anon all over town and at Fluttershy's cottage, you finally come to Sweet Apple Acres
- >You see Anon helping Big Mac lift apples onto his wagon
- >Jeez, Anon rather be forced to buck apples than hang out with the coolest mare in town?
- >You decide Anon doesn't know what 'fun' is
- >You need to get to Anon, but you have to get him without Applejack butting in
- >Idea!
- >Swooping low, you fly into a nearby tree
- A: Great work so far. Going to get some lunch. Do you want something, Big Mac?
- BM: Nope!
- A: Just take it easy out here, man! Keep up your fluids and all that!
- >Anon begins to walk away
- >Now's your chance!
- >You call out to Anon in a hushed voice
- RD: Psst! Anon!
- >Be Anon
- >Is that tree talking to you? The heat must be getting to you
- RD: Com'ere! Fast!
- >You walk under the tree and see Rainbow Dash looking down from the branches
- A: Oh... it's you...
- RD: I know, right? Pretty great seeing me again, yeah?
- A: "Great" is not the first word that comes to mind
- >L: 'Tis such a harsh word for Loyalty, we think
- RD: Aww, come on. You're not mad at me for that night at the bar still, right?
- A: I am speaking to you if only to maintain civility
- RD: Well, what if I promised that I won't make you eat me out again?
- A: What makes you think I'd even give you the chance to make that mistake twice?
- RD: Come off it, Anon! You know you loved it! What pony wouldn't be honored to taste -me-?
- >You scoff and walk off towards Applejack's place
- >You feel Rainbow Dash hovering close behind you
- RD: OK! Alright! I am sorry! That's not why I was looking for you anyways
- >You walk a little slower if only to hear the cyan monster out
- RD: That night wasn't my best decision, but there's not reason we still can't be friends!
- >You process the thought over and smile
- >This might just make your task easier
- >You stop and turn to Rainbow
- A: Fine, if only because you said it first. I will accept your friendship and allow you a sliver of forgiveness
- >L: It is interesting to see how you say one thing and feel completely different
- >It's called, "lying". I thought you knew all about that?
- >L: Oh yes, we do... you just do it with so much misery in your spirit. 'Tis almost depressing
- >You play an annoying song in your head to try and drown out Luna's rambling
- RD: Awesome, now lets go! I got to show you this cool spot to hang out at!
- A: Slow down now, Dashie. I am still working with Applejack
- RD: What's the big deal? Applejack loves bucking apples alone! You should really come with me today
- >You feel Rainbow Dash grab you by your collar and yank you lightly towards her
- >You pull back quickly and turn in place
- A: Look, you! You want this -friendship- to happen? You better start being a -friend-
- RD: I am! I know you'd have so much fun at this awesome spot! There's a great swimming hole and a tire swing and everything!
- >Rainbow loops in the air to emphasize the "fun" you could be having
- A: Fine, why don't we invite Applejack along with us? I am sure she'd enjoy having some fun
- >Dash snorts hard and looks away from you
- RD: If -she's- there, I can't... you won't... ugh, lets just go together!
- A: What's you're problem with Applejack?
- RD: Nothing! Applejack's fine, she's my friend and I like her! It's just...
- A: What? Just what?
- RD: She's... she's... she always takes any stallion I try to get close to!
- >Rainbow's eyes open wide in shock and she covers her mouth
- >You take a moment to consider this information
- A: Are you... jealous of Applejack?
- RD: No! Why would I be jealous of -her-! I am faster, stronger, and way cooler than some workaholic pony who can't even have fun!
- >Dash turns away from you and crosses her hooves over her chest
- RD: I thought I wanted to spend the day with you and we could be -cool-, but if all you want to do is work, well then, who needs you?! I can't believe I let you suck me off!
- >You are fairly confused at this outburst and can't tell where she's mad at you and where she's mad at Applejack
- >L: Anonymous... Loyalty has always been hotheaded. it is how she shows her affection
- >These ponies will drive me to drink. I swear to you!
- A: Look... Rainbro... lets be sensible. I promised to help Applejack and I am -loyal- to my word. Later on, however... maybe we can... go to your -awesome- swimming hole
- >Rainbow perks up without turning to you
- RD: Do you... really mean that?
- A: Yes, as a friend. We can spend friendly, platonic time with each other
- >Rainbow finally turns and looks at you with a smile on her face
- >She quickly hugs you and floats away into the clouds
- >Did I do the right thing?
- >L: We are not sure... your conflicted emotions are interrupting our rational thoughts
- >You make your way to Applejack's home and finally get some lunch
- >Applejack and you finish out the day as the sun meets the horizon
- AJ: Woo, doggy! What'a day! Jus' like ol' time's sake
- >Applejack nuzzles up to you and you run a tired hand down her back
- >Her sweaty fur parts in your hand and you chuckle lightly at the feeling
- AJ: Ah definitely need a bath after all this
- >Her tail rubs your thigh and her lidded eyes stare up at you
- >Those green eyes pull you in and shred your emotional walls
- >Seeing this astonishing mare brings you such bliss that you scarcely care how much life has changed
- AJ: Hey, Anon... what're ya' thinkin' 'bout right now?
- >You smile and take AJ's hat quickly
- >You place it on your head and smile wider
- A: I was thinking about how much luck I must have to have such a wonderful friend
- AJ: Aww, shucks... Ah think yer full'a apple pie ta' be sayin' such sweet things
- >Applejack knocks you to your rump and stands over you
- A: Feisty, are we?
- AJ: Ya' ever make love under the stars?
- >You think about it for a moment
- >L: We have only ever made love in such a way!
- >Ah! get out of my head, you witch!
- AJ: Ya' alright, sugarcube?
- A: Oh, yes... just something on my mind! Or nothing... nothing on my mind!
- AJ: Yer cute when yer flustered...
- >Applejack moves her face close to you
- >That wonderful, musky smell laced with a hint of apple sends a shiver down your spine
- >You reach out and kiss her softly
- >No tongue... only love now...
- >L: We have been in many pony's heads, but this is the first time we have ever felt such enthusiasm for another's kiss
- >You are -ruining- this for me
- >L: Stay endearing just a little while longer... we shall bask in this tingling sensation in silence
- >The voice fades and you finally get to enjoy your kiss
- >You part slowly with barely a sound between the both of you
- A: Mmm, how do you do that?
- >You flutter while looking into her eyes
- AJ: Ah'm more than jus' a one-trick pony
- >L: We do hate to interrupt, however, we should remind you of your engagement with Loyalty
- >You are right this time... but, Applejack...
- >L: We feel... exactly how you ache... we shall resist the temptation as should you...
- A: AJ... today was great, but I need to go home tonight and scrub the stench from my clothes
- >Applejack nuzzles into you and sniffs loudly
- >Her eyes flitter and she sighs
- AJ: Ah reckon ya' smell jus' right
- >She pulls her hat back onto her head
- A: Lets get together tomorrow and I'll treat you to a fine meal at Cafe Giara. Just you and I, no distractions and after all that... well, why not my place? Bed's too big for just one body
- >You flash your predatory smile at her
- >Applejack blushes and nods in silent agreement
- >You break away from her and head out into the setting sun
- >After a few minutes of walking, you hear the swish of something swift in the air
- >You turn to see the blue blur of Rainbow Dash
- RD: Finally! I thought you two were just about to eat each other's face off!
- A: Nice to see you too...
- RD: Anyways, like I said earlier, this place is really awesome and I go here all the time when I just want to get away from all my problems
- >You follow Rainbow out of Sweet Apple Acres and across a section of Ponyville you have never really been to
- A: Are we almost there? I am a little tired...
- RD: Oh, yeah, it's not much further ahead! We're looking for some tall reeds
- >You walk carefully in the darkness now and await the moon to illuminate the sky again
- RD: Oh, right here! Come on, slow poke!
- >You stumble through a gathering of tall reeds and come upon a small hot spring
- >The steam drifts into the cool air and your aching bones sing to you their weariness
- RD: What'd I tell you? Isn't this awesome? Nop0ny knows about it
- A: It does look wonderful... I could use a relaxing bath...
- >You smile and move close to the edge
- >Rainbow Dash darts to you and holds you back
- RD: Where do you think you're going?
- A: In... the spring?
- RD: Not like that! I know all about what happens when you clothes get wet
- >You suddenly feel that this was a convoluted attempt at rape
- >L: Give Loyalty the benefit of the doubt
- >Go to sleep, Luna!
- RD: I... I could help you... if you want...
- >You glare at Rainbow with sharp eyes
- >She floats backwards to give you space
- A: Turn around...
- RD: What? Why?
- A: Because I asked you kindly
- >Dash spins in place and pouts to herself
- >You slip off most of your clothing save for your boxers and slide into the pool
- A: There we are... oh yes~
- >Your body forgives you after the long day
- >Rainbow hovers above you for a moment before bending down to meet your face
- RD: Pretty awesome, huh?
- A: I will admit it is... so relaxing
- RD: Best part is it's free and never closes. Yep, we could hang out her all night if we want to
- >You sink in your spot and let the warm water caress every aching muscle
- >Closing your eyes, you drift casually in your mind
- >So warm and comforting
- >The sound is so soothing
- >That wondrous feeling of a fuzzy body pressed up against your...
- >You open your eyes to see Rainbow Dash pressed against your side
- A: Dashie... what are you doing?
- RD: Oh... I was, uh... trying to rub your back?
- >You eye her over once and she fidgets nervously
- A: Look, Dash... I appreciate this... all of this. It was nice of you to show me this spot and even recoup our friendship, but you have to understand that I don't want to be physical with you
- RD: Puh... fwhh... that's not fair!
- >Rainbow Dash doesn't leave from your side
- RD: You had sex with Fluttershy just yesterday! She told me all about it!
- A: That was mostly against my will...
- RD: I was hoping if I was nice you would just do it like with Applejack
- A: Dash, I did not start a relationship with Applejack out of the clear blue. We spent a lot of time together
- RD: All you two ever did was work! Applejack is a boring pony who never has fun! It's always apples, apples, work, apples!
- A: That is not true... she has a different attitude entirely outside of work
- RD: Well... she never shows it! I am so much fun to be with, Anon...
- >Rainbow kisses your shoulder
- RD: I mean it... you'd have the best time ever
- >Dash's hooves run down your tired chest
- A: Don't go any further
- RD: But, I know you want it... me... I'll do everything for you... to you...
- >Rainbow Dash kisses your collar bone and up your neck
- >L: We did not foresee this from Loyalty
- >Really? You really didn't? Well, help me here! My body is totally falling apart!
- >L: We are formulating an idea...
- RD: Anon... just love me... I can be Applejack tonight...
- >She slides around the water and sits in your lap
- >Her wings wrap around you and she pulls herself close to your body
- RD: You know I really like you... yeah? I thought about this... I even rubbed one out thinking about you...
- >Your hands are limp at your sides from weariness
- >Luckily, not even your crotch is responding
- RD: Come on... please? Grab my flank... you can... you can do what ever you want to me... I won't stop you... you could... you could even touch my wings... but, be gentle if you do that...
- >Dash tries to grind into you lap with little response
- >Your face is twisted with fear and anger as Rainbow tries her best to seduce you
- A: This isn't fun... I am not having any fun with you...
- >Her body stops almost immediately
- RD: W-what are you talking about? I'm loads of fun... I am more fun than Pinkie even! I-I'll prove it! Name one fun thing and I'll do it!
- A: Fun things to do with friends are talk or dance or watch movies. Friends wouldn't trick someone into having sex. Friends would listen to each other...
- >L: Oh! We have an idea now! We will assume direct control while you recover your psyche!
- >You're doing what?
- >L: Sleep, Anon... we shall take the dire situation up ourselves!
- >Your eyes close as you slip into a sudden slumber
- >Be Princess Luna the Body Snatcher
- >You open Anon's eyes and look through them
- >The blue gaze of your eyes shine through and cover up Anon's natural eye color
- >This body feels... unusually heavy by pony standards
- L: Loyalty! We command you to stop your futile efforts!
- >Dash looks into your face
- RD: P-P-Princess Luna! What are you doing inside Anon?!
- L: Anon has been rendered comatose! We shall take his shell back to his home now!
- >You stand up and fumble on two legs
- >Oh... how does he do this?
- L: We shall sit for a spell as we become acquainted with our motor skills!
- >Loyalty is laying in your lap and you feel a tremendous warmth inside you
- >Her silky fur is pressing against your bare flesh... quite an amazing experience
- L: Now, we shall attempt to leave again. Fare-thee-well, Rainbow Dash!
- >You stand up again only to fall onto your back with half your body in the water and half out
- >This is really hard
- >You lift your head to see Rainbow Dash floating above you
- RD: Do you know how to work that thing?
- L: Of course! 'Tis an easy vessel to command! We are just... tired, yes~!
- >A: Luna! Give me back my body before you break it!
- >Anonymous! Why are you not resting?
- >A: This isn't helping! I am not mentally tired!
- >Your eyes catch a glimpse of Rainbow Dash's wet marehood and you are overcome with male feelings
- >A: Oh hell no! Stop looking, Luna! You don't know how to be me!
- >Anonymous... is this... the true feeling of love?
- >A: No, you horny fiend!
- >Are you certain? We feel our fondness rising
- >Your maleness stands at attention and you fumble your new human hand to it
- >An inexperienced squeeze makes you coo
- RD: What are you doing, Princess?
- L: Y-your princess loves you very m-much. You should love us as well!
- >A: Luna! Do -not- use my body to get yourself off! I will destroy you!
- >But, Anonymous... this dirty appendage is too convincing!
- >A: Snap out of it!
- RD: I love you, Princess Luna... but, how does Anon feel about this?
- >A: Tell her to DIAF and give me back my damn body!
- L: He is screaming for your body on his! Truly! Ah~, help your princess!
- RD: I knew he couldn't resist me! I am too awesome to say "no" too
- >With lightning speed, Rainbow Dash exposes your sex and takes you in her mouth
- L: Oh~! This feeling... we are at your mercy!
- >Dash sucks from base to tip with relative ease thanks to her muzzle
- >A: Luna... Luna! Stop her!
- >We can't feel your toes...
- >You drool as Dash deep throats your new body
- >Within moments, you feel a full-blown male orgasm and rock your human pelvis with great force
- >Your rod pops free from her mouth and sprays a thick, juicy glob of crème across her muzzle and in her rainbow mane
- L: By... the... heavens... Anon... this is... incredible!
- RD: Forgive me saying so, Princess, but Anon should last longer than that...
- >A: Stop using me like this!
- >Yes... we will be vesting control back to...
- >A: Oh, hell! That feeling!
- RD: I want to make my Princess happy...
- >Rainbow Dash inserts you as quickly as she can
- L: Oh~! L-Loyalty! Your princess adores this!
- >Anon can do nothing save for watching you use his body in this lewd manner
- >You spear Rainbow Dash onto your mighty shaft a dozen times before filling her belly
- L: Aah~... yes~... such an amplified experience... woo~
- >A: Are you quite done yet?
- >We do apologize, Anonymous
- >A: Yes, I am sure you do... now, give me back my body
- >We shall do so... for we need a nap after such excursions...
- >Be Anon
- >You "awaken" to see Rainbow Dash glued to your member
- A: Luna is really bad at planning...
- RD: Oh... Anon... you're back... did you feel it?
- A: Not even a little
- >You quickly slide Rainbow off your spent body and drop her to the ground
- >She just lays there, panting like a wanton harlot as Luna's handy work leaks from her crotch
- RD: Oh, I was hoping you would... I want you to see how good I am
- A: I don't know -why- you mares think sex is the end-all-be-all of a relationship... I am getting too genre savvy for this tripe!
- >You gather your clothing and stomp off in the rough direction of you home
- >You keep learning how much control Luna can have over you at any moment and worry
- >What will keep her influence at bay... what could stop her?
- >You feel the symbols on your chest twist a bit and see the thunderbolt grow slightly
- >Still smaller than the butterfly, but larger than before
- >You think you will have to find a way to keep Rainbow Dash happy and not keep unloading into every mare you need to befriend
- >Ugh, this could have all been avoid if not for
- >Fucking Fluttershy!
- ------------------------------------------------------------------------------
- >Day Happiness is Not a Warm Scalpel in Equestria
- >Be Anonymous
- >The previous night was exhausting and mildly uncomfortable as you learn that Luna can physically control your body
- >You plan to find a way to resist her and you know just the pony for the job
- >After the morning's usual activities of eating and bathing, you head out to visit Twilight
- >It's a fairly short trip to her library home
- >You knock at her door quickly and await a response
- >After a few minutes, the door swings open to reveal a little purple dragon
- S: Oh, hey, Anon! What's up?
- A: Nothing much, bro... you see Twilight around today?
- S: Oh yeah, man. Let me get her for you
- >Why can't ponies be as levelheaded and bro-esque as Spike?
- >Spike invites you in
- >You look up from the ground floor to see Twilight Sparkle trotting down the steps
- TS: Oh, Anonymous! Nice to see you here. Can I help you with something today?
- A: Magic...
- TS: But, you're not a unicorn?
- A: No, I need defense against magic
- >She looks at you curiously
- TS: Well, I am not sure if I can teach you something like this... I mean, what are you even trying to defend against? Magic is complex and every spell is different
- A: It's... it's hard to explain
- >L: Hello! What's going on in this head?!
- >You physically jump as the booming voice startles you
- >Twilight backs up a bit
- TS: Are you... OK, Anon?
- A: Yes... yes, I'll be fine...
- TS: So, what did you need defense against again?
- A: Um... I suppose we can call it telepathy messaging?
- TS: Is somep0ny beaming strange sounds into your mind? Because I ended that experiment months ago after seeing it has no observable effect on you
- A: No, no, it's... wait, what?
- TS: Nothing! Well, I don't know if I can teach you a spell for this kind of thing. Hang on
- >She trots down and searches for a book
- >She finally pulls one from her many shelves and begins reading through it
- TS: Magic... rings... ah! Here we go! There is an enchantment that would allow a skilled unicorn to imbue a magical barrier on an item that -might- be able to block out telepaths from sending messages into your head
- A: Would that stop all sound?
- TS: It -should-, but it looks like pictures would still get in. Are you seeing strange images, especially images of anything that would seem like heresy to the Princess?
- A: No, nothing like that...
- TS: Good! Because it says here that Tartarus' minions -could- influence easily susceptible ponies into doing their bidding... hmm
- >She looks you over carefully
- A: I promise, this is for a simple matter and has nothing to do with bad influences
- >L: Anonymous, we are most displeased with your thoughts here. You shall not be able to silence the Princess of the Night! My magic is law!
- >A large radio appears in your mind
- >Luna looks up at it as the lights begin to flash
- >♫If you, want to call me, "Baby"! Just go ahead now!♫
- >Luna covers her ears and flails around as she tries to silence the music
- >You have drown her out for now, but at the terrible price that this song is stuck in your head
- TS: Well, I don't see why we can't try this... but, it's very taxing and I am going to need to charge a fee
- >She smiles widely
- A: How much?
- TS: No bits... I want a four hour long session of asking any questions and testing varies, non-lethal spells on you
- >She smiles even wider now and you are nervous to say the least
- A: Wow... so this seems entirely crazy... a two hour session instead?
- TS: Two and a half hours and I get to test a polymorph spell on you
- A: What is that?
- TS: A spell that transforms bodies into other bodies... it's also non-lethal, however I can only do it easily on a willing subject... so, what do you say?
- >She looks at you with her large eyes
- TS: Contract?
- >Eh, it can't be worse than your current situation
- >You extend a hand and take her hoof in a firm shake
- TS: Oh, goody! So, I can't waste this opportunity! Spike, get my collective tome of Anonymous' history!
- >Spike salutes and runs off
- A: You have a -tome- about me?
- TS: Why wouldn't I have a tome about you?
- >You shrug with more confusion than worry at this turn of events
- >Spike reappears with a massive book nearly twice his size
- A: I like the silk and oak binding...
- TS: Thank you...
- >The compliment is fairly hollow as Twilight loses all focus in her reading
- TS: Aha! I am so happy I write these down all the time! OK, this was a good one. Did you have a formal education?
- A: I believe so... I did so many years of primary and secondary schooling as well as a year of time in a university for a researching degree in astronomy
- TS: Interesting... excellent! Next, how many segments would you say are in the human spine, specifically the number of vertebrae between the thoracic and lumbar segments?
- >You look at her and grimace
- A: I... am not entirely sure...
- >She looks at you and sighs lightly
- TS: No worries... I will save that for later... Alright, this is a good one! Do humans have a polyestrous cycle as ponies -or- is it diestrous?
- A: I don't even know what those words mean
- TS: Simple, really. Do humans breed seasonally, polyestrous, or do humans breed twice a year, diestrous?
- >You think for a moment
- A: Humans can breed any time they want, I believe... I guess more people conceive during the winter months, what with vacations and confinement. Humans are kind of like bunnies!
- >Epiphany!
- TS: Oh? Now I would have never guessed that... but, you're too tall and you eat so much? Would that mean that humans only have one foal at a time?
- A: Yes, exactly. A woman has, on the average, one -child- at a time. There are oddities, like having twins or more at once. That is a rare though...
- TS: Incredible! You can breed whenever, but have near identical breeding circumstances as ponies! How long, in days, does it take to have a human child?
- A: Uh... normally nine months and that would be about... 270 or so days. It's not too uncommon for children to be born a month or two earlier than the expected date
- >Twilight frantically jots notes as you speak
- >In this state, you could almost swear she's a real scholar
- TS: OK... do you know the parts of a human female's anatomy?
- >You smirk and puff out your chest
- A: I'd like to think I do...
- >You chuckle a bit
- TS: Excellent! Please draw a diagram for me and make sure to label each part of the reproductive tract as closely as you can. I need accurate anatomy charts to compare everything
- >You cringe and look at Twilight's completely casual smile
- A: Well, I don't know it -that- well...
- >You kick your foot a bit and shrug
- >You wish you had a book to give her on this
- TS: Well... those are all the major questions I think I can get out of you... so, that would mean
- >She looks at you with starry eyes
- TS: Practicum time!
- A: Say what now?
- >She leads you down the stairs to the ground floor and to a bookcase
- TS: Open Sesame Seed!
- >Her words echo and the bookcase fidgets and slides to one side
- >You see a winding staircase descend into dark nothingness
- A: Neat trick... well, guess it's time for me to go!
- >You turn and begin to walk out before a tug of magic grabs your collar
- TS: You said I'd get two and a half hours and non-lethal spell usage...
- A: So, why do we have to go where no one can hear me scream?
- TS: Oh, Anonymous, you silly colt... this room doesn't have soundproofing just yet...
- >She drags you along with her and you see the light fade from view
- >Small lanterns guide you down as you are pulled deeper into the very earth beneath you
- >You finally reach the bottom and come to an artificially lit room
- >The walls are painted white and a smooth table sits in the very center
- >A shiver crawls up your spine and straight to your brain as you imagine what Twilight does down here
- TS: Welcome to my testing lab! The walls here are magic resistant and block most outside spells and contain anything cast inside it. Now, if you would be so kind as to get on the table
- A: I don't wanna...
- TS: Come on, you're wasting valuable research time!
- A: What are we going to do on the table?
- >Pomf
- TS: I am planning to run some routine tests on you, mostly biological tests to see more about what makes you work...
- A: If you pick up any instrument sharper than a sponge, I don't want anything from you ever again!
- >She smiles
- TS: No, no... vivisection is reserved for unintelligent creatures...
- >You cringe and cautiously walk to the table
- >You lay down to find it is not as hard as it looks
- >The metal must be magical or something
- TS: Comfortable?
- A: Should I be?
- TS: Of course! I need you to relax so this spell will be effective
- >You breathe easy and try to think of a happy place that is not underground
- TS: Alright! This is going to be a long test, I still have two hours remaining... and four minutes... so, the first test will require some fluid measurements
- A: Which fluids?
- >Twilight holds a beaker to her face and smiles
- TS: All of them...
- >A bolt of magic zaps you and you feel oddly breezy
- >You look at your skin to see that... you can see through your skin
- >Your muscle and sinew is exposed and you do your best to not freak out
- TS: Look at that! Amazing structure! Now, please remove your clothes. I want to get a good look at your organs next
- A: I don't like this very much...
- TS: Please cooperate or I'll be forced to remove your clothes
- >You sneer and slowly take off your outfit
- >Looking at your body is like looking in a medical dictionary
- >Kind of makes you sick to see all the processes in real time
- >A long while passes as Twilight bounces around you with a sketch pad
- TS: There we go! Drawing your digestive tract was a real chore! Human parts are pretty complex, but not entirely dissimilar! Hold still again...
- >Another zap of magic makes your skin burn a bit
- >You have the strangest taste of blue on your tongue
- >You see your skin start to take colour once more
- A: Thanks! I was missing being opaque...
- >You see your groin flesh back out and cover it with your hands
- A: Mind handing me my pants?
- TS: Not yet, I need to draw this... your penis and scrotum...
- A: Really? I don't remember...
- TS: Full-body study! We're almost done and I barely have thirty minutes left!
- >She's really good at keeping time
- A: Fine...
- >She eyes your sack for a while and draws now and again
- >This is not fun in the slightest
- >You barely take your junk out in the light around Applejack
- >Your mind snaps to as you feel a quick rush of air and hear a sniff
- A: Hey! Watch it!
- TS: Why do you smell like apples?
- A: Because... reasons
- >Twilight thinks for a moment
- TS: Oh, wow... have you and Applejack been breeding?
- >Just be cool about this
- >Twilight is sort of a friend, she shouldn't get mad at you
- A: Now, listen... Applejack and I are pretty steady...
- >She cuts you off and smiles widely
- TS: I had no idea if your body was mature enough in pony terms! Oh, you have to tell me everything! Was it pleasurable or did it hurt? How long and wide are you at full length? Is it relatively the same as copulation with female humans? How many instances a day do you two copulate? How long, on the average, do you rut for? Is it possible to...
- >The barrage of questions keeps up
- >You just kind of sit there in your barely covered position
- >She finally stops talking and looks up at you with hugely curious eyes
- >It's like a small child talking about candy
- >Only this is infinitely more disturbing to you
- TS: You know what? This is a lot to ask you and I am sure it's very personal
- A: Oh... thank you for understanding... now if you could...
- >She raises a hoof
- TS: I'm not done... we have twenty-seven minutes and are still in my workshop. We could answer all of these questions with time to spare the easy way
- >She hops to her hooves and wags her bottom before you
- TS: Go ahead, Anonymous. I think you'll find that I am nearly proportionate to Applejack. Oh, so exciting! Physical application of theories is the best!
- >Her tail lifts up and sways before her
- >She cranes her neck around and looks at you
- TS: Why are you wasting time now? Hurry up!
- >You are kind of confused
- A: Are you... coming onto me?
- TS: What? No! Don't be crazy! I just need to you insert you penis in me while I use this spell to record data
- A: So, you're trying to get -me- to have sex with -you-?
- TS: No, no! This won't be sex! It's research! Now, hurry up! Only twenty-five minutes left!
- >She leans her front half down and curls her tail around her flank
- A: If I said I didn't want to screw you...
- TS: For the last time! This is -not- sex... I just need you to ejaculate inside of my body as quickly as you can and as many times as you can for data! The metrics are falling apart for every second you waste!
- A: Twilight, I am not doing this...
- TS: Why not?! You promised to do all the research I wanted for two and a half hours!
- A: I did -not- think it would lead to this!
- TS: That's why I am so desperate! We have so much science to perform and you're just sitting there!
- >You feel your member being tugged by Twilight's magic
- A: Hey! Take it easy! Pulling like that is going to rip something!
- TS: If you don't hurry up, I'm going to take action myself!
- A: I don't want the ring anymore. I'm leaving...
- >Twilight's face goes pale
- >She turns around to face you
- TS: What? But, my notes! All the research! It's so close to complete! Please, Anonymous, don't leave until it's finished!
- >You heave a sigh and look at her
- A: Is there another way we could do this?
- TS: I suppose so, yes!
- >She hands you a cup
- TS: Ejaculate into this. I want to see how many milliliters you produce
- >She has the creepiest smile on her face right now
- A: Is there... another way?
- >She looks frustrated with you
- TS: I... I, ugh... not really! Maybe we could just go for a distance test? You can masturbate in front of that colored stripe and I'll record how much velocity you ejaculate at? Choose something fast, we only have seventeen minutes left!
- >You shake your head
- A: I don't really feel like doing this at all...
- >Twilight rubs her chin for the moment
- >She smiles widely and nods
- TS: I understand! Your species is based around visual cues and you just can't form an erection! Say no more, I'll handle the easy part
- >Before you get to speak, Twilight's horn glows brightly
- >The light blinds you for just a moment
- >When you can see again, Applejack is standing before you
- >You look around to see a clear sky over head and rows of apple trees on either side of you
- >You're sitting on the table still, but everything else looks and even smells like Sweet Apple Acres
- >Applejack approaches you
- TS: There! Is this a better atmosphere for you?
- >C'est quoi cette merde?
- >Twi-jack turns around again and presents her hind quarters to you
- TS: While I can't say for certain that you and Applejack have had intercourse outside in the orchard, I would imagine it would happen. Having said that, you should really hurry up...
- >Your mind is full of fuck right now
- A: Twilight...
- TS: Call me, "Applejack" to improve the immersion
- >You look sternly
- A: I am not going to do that
- >Twi-jack clears her throat for the moment
- TS: But, An-on, ya'll rilly got to hurry on up an' rut mah bottom!
- >This is borderline mind rape
- >Feels like you're in the Twilight Zone... the show...
- >Not this actual zone created by Twilight... fuck
- A: Look, I just want to get off this wild ride!
- TS: What? We're not on a ride! We only have ten minutes... can you get moving? I mean, "Can ya'll git a'movin'?"
- A: Lord, you impersonations are awful...
- >Twi-jack turns around to you again and sighs
- TS: Do you want that magic ring or not? This feels like a big waste of perfectly good experimenting time now and my butt's getting cold from wagging it in the air so long! We have almost no time left now and if you don't give me -some- data, this contract is over!
- >You're little stallion rises as you look at Twi-jack's shapely backside
- >You try to press it down, but it's not fooling anyone
- TS: Oh? Interesting... Perfect! Now, simply put it in me. I would prefer it in my vagina as I could take the most accurate measurements that way
- A: How does that even work?
- TS: Easily! I cast a simple spell that allows me to feel things in both quantity and quality and allows me to quantify sensation as well as physical changes. I'd be able to record all kinds of data!
- A: Well, even if you look like her, you're not. I'm not going to play this game. Just... take what you want and be done with it...
- >She smiles widely
- >That beautiful smile of your gorgeous, green eyed mare
- >Your mind dreams of her for the moment
- >A sudden cool, wet feeling snaps you back to Twilight's reality
- >You see Twi-jack's face beginning to swallow your maleness
- A: OK, fine... but, I won't enjoy it...
- TS: Enjoy this? Impossible! This is -not- sex
- >She returns her lips to your sex and takes you into her muzzle
- >Almost immediately do you find that Twilight is rather inexperienced at this
- >Her teeth bump your sensitive tip multiple times and her tongue seems to get in the way
- >It's seriously impeding your orgasm
- >You dare say this is the worst blowjob in the history of the act
- >Twilight removes you for a moment
- TS: Oh... we only have two minutes and you've still not ejaculated... my mouth is sore and it's going to corrupt the data if I continue like this...
- >Her whining almost makes you feel bad... almost
- A: How about we forget this whole thing ever happened?
- TS: Why are you being so mean and uncooperative?
- A: Pardon? I have been the best subject of any experiments I've ever seen
- >Twilight lets out a sigh of defeat
- TS: I was hoping you'd use my backside because... well, technically speaking, I'm really not good at this whole... sex thing
- >She looks away shyly
- A: Can you drop the Applejack image? It would improve my feelings at the very least
- >The room flashes brightly again
- >You close your eyes this time
- >When you open them, you are back in Twilight's sterile lab with a purple unicorn staring at your crotch
- TS: We only have a minute now... less now... even less now
- >You hop to your feet with a raging erection
- A: I am sorry, really... I just don't like doing it with other ponies
- TS: I keep telling you, it's not sex. I just wanted to finish these metrics and close out that chapter of this book. It's going to be the best guide on humans ever and it needs to be accurate
- A: How many other humans do you know of that you need a safety guide on them?
- TS: Well, I know you... and what if other ponies want to know you? They all can't meet you... that's what books are for! You can read about the things you can't see or do...
- >She looks down at a blank page and traces it carefully with a hoof
- >This is fairly depressing
- A: Look... I... I just can't do this behind Applejack's back. I feel awful
- TS: What if she sanctions my research?
- A: I... don't even understand how to feel about that sentence!
- TS: If Applejack says it's fine for you to ejaculate in me for the purpose of my research novel, would you?
- A: I don't see why she would do that... but, if she did, for whatever reason, I guess I would
- TS: I realize you are based on both your mind and senses when it comes to sex... does that mean you really don't find me as appealing as Applejack?
- >Oh boy... now this...
- A: That's not it... I love Applejack. She's amazing! You an I, we're just barely friends. We don't really even associate with each other outside of these rather specific scenarios
- TS: Yeah, you're right...
- >She clutches her book tightly to her chest
- TS: I was going to give you a copy when I'm done... it is a book about you, after all. I just want it to be right. Maybe, when you read it, you'll see that I tried really hard to get to know you... sometimes, I just have trouble making friends with ponies... people... both now
- >You stroke her mane gently
- >You bring yourself to her height and hug her
- >It's kind of awkward when you're naked, but she's warm and soft on your skin
- A: You don't have any problems. You have five great friends and we could certainly try to be closer... if you stop trying to kill me
- >She looks at you with misty eyes
- TS: I didn't mean to hurt you... I just wanted to have all the facts
- >You pet behind her ears
- A: Well, just treat me like you would treat any other pony. I would like you a lot more if you'd stop experimenting on me... and if you gave me back my clothes
- >She sniffles and you see your outfit conjured through her magic
- A: You're alright, Twily...
- >You nuzzle her head and she smiles
- >You stand to your height and carry your clothing to one side of the room
- >Your maleness is still throbbing despite everything
- >Maybe there is a way you can still help Twilight...
- >You reach for a measuring cup and set to work
- >Racing thoughts of Applejack in you head, you spill in record time
- >Your aim could be better, but you got most of it in
- TS: Anon? What was the sound?
- >You sigh and shiver happily to have that out of you
- TS: Oh... did you just?
- >You present her the cup of you
- A: Here... don't say I never gave you anything!
- >You proceed to dress yourself
- >While you are busy, Twilight stares intensely at her "gift"
- >You see a flash of blue light engulf the cup and it vanishes
- TS: Oh~! So much data...
- >Twilight looks a little fuzzy around the edges as a smile creeps along her snout
- >She hums lightly to herself
- TS: Amazing! ATTAGCCGATGCGCCTAATTATATAGCGCAT! Whoa, that's a lot of pairs... better start writing this down! You know, your semen is not very different than a ponies! Comparably salty, but I attribute that to your peculiar eating habits
- >She smacks her lips a few times
- >Twilight fiddles with a quill and her notepad for some time and you simply wait around
- >After so many minutes, you catch her attention
- A: Do you have everything you need?
- TS: Not everything, but this helped a lot! I thank you so much for that sample!
- >She holds her sketch book to you and you see she is drawing a double spiraling ladder with the letters AT or CG on any given line
- >You're no molecular biologist, but cartoons have taught you all about super-science!
- TS: Yes! That works! Now the DNA can properly overlap! Oh, I wish I had more research notes on this... if only there was a way to see these tiny structures first hoof...
- A: What about an electron microscope?
- TS: A what?
- A: I have no idea... I stopped watching the show to go to work
- >You frown
- TS: Well, at any rate... this is great stuff! Now, I have to uphold my end of the deal
- >Twilight's horn glows for a moment and her eyes fill with energy
- >While charging, you see her staring intently at your chest
- >Her horn's glow lowers, but her energy charged eyes remain
- TS: What is that symbol on your chest? Take off your shirt again
- >Oh no, can she see it?
- TS: Somep0ny has cast a binding spell on you... but, who would do that?
- >You laugh and turn around
- A: Oh that? It's nothing big... you know how all the cool kids are magically soul binding each other these days!
- >Twilight's magic completely fades and she looks you over
- TS: Is this why you came here for magical defense? Honestly, that aura is too strong for my skills. You should have just told me about that mark earlier!
- A: It's... it's from Princess Luna
- TS: What? Why would she need to bind you?
- A: I don't know if I can say because she can read my thoughts and emotions. I am not sure if she can currently hear me, but I haven't heard from here since we came down here...
- TS: Oh, well, if it is the princesses... I wouldn't want to get in their way. Is it something important?
- A: I believe so... it's difficult to explain and I don't really want to get into it
- TS: Understandable! Royal business is usually discreet
- >You nod
- >The two of your climb the stairs back into the world
- >It's good to see sunlight again even if the sun is already setting
- TS: Well, I suppose I couldn't do anything for you... I am sorry
- A: It's... fine. I don't even really mind. I do have to meet Applejack tonight, so I'll be off shortly
- >Twilight looks at you quickly and nods her head as if agreeing with herself
- TS: I -think- there's something I can give you in the name of science and metrics that would be beneficial to the both of us
- >A sly grin crosses her face
- A: Don't make me see-through again or so help me!
- TS: No, no... I think you'll enjoy this spell a lot more. Applejack will, at the very least
- >You barely register her comment before a beam of pink light blasts your crotch
- >You are knocked to your knees as a pain envelopes your groin
- A: And after everything I've done for you today!
- >You clutch yourself carefully and whimper
- A: If you broke anything down there, I'm going to shave you bald and feather you...
- >You look in your pants to see... oh my...
- >You giggle a little and reach down
- >In your palm is a thicker, weightier piece of meat
- TS: If my calculations are right, at full erectness, you should have nine inches of length from tip to pelvis and one and a two-thirds inches in diameter. Just be careful using it the first few times
- >You fond yourself in the light and beam over your flesh
- A: What's this pink mark around the base here?
- TS: Metering...
- >You cock an eyebrow at her
- TS: Well, if you end up touching that pink line, I'll be able to recall the data. Nothing too personal; just velocity, time, season and amount of ejaculate released...
- A: I would be angry, but I have a nine inch dick! It's pretty much worth anything you're saying
- TS: I am glad you see it that way! Have a good night with Applejack and, um... thank you for everything. You're really a good friend...
- >She trails off a bit and looks at you timidly
- A: It was... not bad! See you soon?
- >Twilight's ears perk up as she looks at you
- TS: Oh? Yes, yes of course! We should see each other again soon!
- >She taps her hooves together as you wave to her
- >You make your way back to your home and tidy up
- >Squat, trim and bathe
- >Something about this routine makes you feel like it's a whole new day...
- >You chuckle to yourself
- A: No, that would be silly if...
- >You hear a knock at the door
- A: Whoa...
- >You strut quickly to the door and open it to see Fluttershy standing in your way
- F: Oh, hey, Anon! Glad to see you are home... are you alone?
- A: I -might- be... why?
- F: I need somep0ny to talk to and, well, you're the only one in town today
- A: I'm sorry, but I'm not a pony either! Looks like you'll have to bug someone...
- >She steps through you easily and rests on your couch
- F: I miss sleeping here...
- A: FlutterButt, I did not invite you in
- >She lays on her side and rests her head on a pillow
- >A happy sigh escapes her lips
- A: Flutters... I am leaving very soon...
- F: Oh, sorry, I'll be quick... I've been having a problem the last few days. I've been thinking about you so much, but it's not like usual. Usually, I would just try to guess your fetish and hope I was right so that you'd finally love me. I realize now that it's not working... and then I thought of you and Applejack
- >You rub your eyes and sigh
- A: Flutters, I am sorry... but, really, it's not going to happen between us
- F: I know and that's why I came to you for help. You don't love me, but I love you! How do I just stop?
- A: I... I don't know? Just, go find a nice stallion?
- >She sighs
- F: I've actually tried that... they aren't like you. They don't make me happy like you do. Even when you would throw me out or yell at me, I never stopped wanting you. Why are you so perfect?
- >You laugh harder than you should at that line
- A: I get it... no, StutterThighs, my fetish isn't overly sappy exposition
- F: I'm not trying to guess your fetish! I... I really came over for advice!
- >You feel a tad bit bad about this whole thing
- >Worse yet, you still want to see Applejack more than help Fluttershy with her "issues"
- F: You see it's not me though, right? Rainbow Dash told me how you two had sex last night...
- A: We did -not- have sex!
- >L: We see what you want to say to her and we would suggest against this. Do not divulge our intentions or true
- powers
- A: It was... rape! Yes, straight rape... I was asleep and Rainbow just used me. I didn't want anything to do with it
- >Fluttershy sighs a little
- F: She's had you twice already and Applejack's your true love... I feel so... just so sad that I can't stop wanting you
- A: Didn't you drug me and use my comatose body?
- F: Yes, but that was -before- I realized how wrong I was for that. I feel so bad that I tried to take advantage of you. That's not love! It's just... just... oh, just me being a big pervey pony! I thought all I wanted was your weird thingy inside me, but now I see that's not it!
- >You look at the sun as it touches the horizon and you know you need to be somewhere
- A: Look, would it help if I let you sleep here tonight?
- F: Do you... do you -really- trust me?
- A: Not even a little, but, I need to give you the benefit of the doubt... you get one more chance to be my friend. Not friend with benefits or lover. Understand?
- >She nods to you and lays her head back down
- A: I need to go out now, however, I'll be back sometime later tonight. Eat whatever you want. Couch is all yours. See you later!
- >You smile and wave as you walk out the door
- >You can't see Fluttershy's face, but you hear her sobbing as you shut the door
- >Why are the quiet ones always crazy?
- >No matter! You have a date to keep!
- >You race to meet Applejack at the restaurant
- >Success!
- >As you arrive, you see Applejack hanging around the front door
- A: Applejack! How are you? I did not mean to be late, I just had last minute guests
- >You notice she is not looking very happy
- AJ: So, ya' did remember ta' show up. Ah was jus' waitin' 'round here ta' tell ya' Ah don't want yer fancy super an' Ah don't wanna waste no more time with yew!
- >You freeze in place
- A: Applejack?! What... I don't understand?
- AJ: Oh, ya' don't? Ah'm mindin' mah own business, pullin' an honest day's apple barrel, when lil' miss cloud-strut shows up. Ya' know what she tells me?
- >You shake your head in astonishment
- AJ: She tells me how yew an' her went down to the springs an' banged like bunnies!
- >You hold your hands out and plead
- A: It's not true! I didn't lay a hand on her!
- >A: Luna! Help me here!
- >L: What would you like us to do?
- >A: Tell Applejack it's not true! Tell her it was you!
- >L: We cannot reveal the mission. It would compromise everything!
- A: I swear, Applejack! You are the only pony I want in my life!
- >You try to move closer, but she moves further
- AJ: Rainbow's many things, but a liar ain't one'a 'em! Ah jus' can't keep doin' this. If ya' ain't honest with me, Ah honestly don't wanna bother waitin' 'round fer ya'. Goodbye, Anonymous...
- >She turns and walks off
- >Your heart sinks
- >It's as if someone reached deep within your soul and removed a pillar that supported what little happiness you had
- >You turn and slowly make your way down the road
- >The walk is longer than before and you have a lot of time to think
- >L: Anonymous... we are sorry we cannot intervene...
- >A: This is your fault, you wretch
- >L: We beg your pardon
- >A; Don't be stupid... you can feel my hate right now. It must be devouring you steadily
- >L: We admit that your passions are burning... the image of strangulation is also rather shocking, but understandable!
- >A: Why is this happening to me? What did I ever do to you that you would cause me so much pain?
- >L: We mean you no harm in the arts of love. 'Tis a fickle game at the best of opportunities
- >A: Applejack just dumped me because she thinks I fooling around with Rainbow! She thinks all I do all day is rut other mares! I am trying desperately to not deal with these ponies simply because they are all rapists!
- >L: Anonymous... just calm down. Honesty wears her heart on her sleeve and is prone to raw emotions. Her stubborn nature breaks down when she has time to think on her own
- >So, what? You are trying to tell me she'll just come around and forgive me? I really can't believe that!
- >L: I am just saying you should let her rest and clear her mind. I know she does not despise you as much as your emotions may think
- >A: How do you know that?
- >L: The mark on your chest hasn't changed size... she has static feelings for you as a friend
- >A: As a friend... not a lover... not a significant other... just leave me alone, you witch
- >You physically spit to one side as if Luna could see you
- >Your mind is suddenly empty and you feel alone
- >The sky darkens and the stars begin to shine
- >How you miss the safety of the night before Luna came into your life
- >A sudden breeze blows past you
- >You turn to see Rainbow Dash hovering nearby
- RD: Hey, Anon! Am I ever glad to find you! I was thinking we should...
- >You stare her down and pin her in your sight
- A: You wicked creature... You filthy, wicked beast! You made Applejack leave me
- RD: Whoa... she just dumped you that easily? I had no idea... well, too bad for her, right?!
- >You twitch as your bloodlust builds
- RD: Hey! So, now that you're free of -her-, why don't you hang out with -me- tonight?
- >She smiles a toothy smile
- >You don't want her to ever smile again
- >A voice suddenly booms in your mind
- >L: Anonymous! Let go of this anger! It is not natural!
- >A loud Italian opera plays in your head and oppresses Luna
- >You see her screaming out to you, but hear nothing over the music
- A: Rainbow Dash...
- RD: Yeah? What's up?
- >You move to her with dark intent
- >You grab her body and pull her into your own
- RD: Wow, you work fast! Glad to see you're over that workhorse...
- >You hands quickly close around Rainbow Dash's neck
- >You hear the delightful sound of gagging emanate from her
- A: What kind of -friend- would I be if I didn't share the -love-?
- >You squeeze her throat tighter as she struggles
- RD: A-non! S-stop...! Can't... breathe!
- >The music in your head is nullified as an intense pain forms in your chest
- >Your grip loosens for a moment before you redouble your efforts
- >L: Anonymous! Cease and desist!
- >You look at Dash's face as a lovely purple shades her cheeks
- >The pain in your chest kicks you harder now
- >You lose your grip as your body convulses in shock
- >Rainbow Dash quickly gets to her hooves and pulls herself away
- >You hear her gasp and cry as she sits in a corner and watches you spasm
- >L: This is for the good of Harmony!
- >Your nerves feel like they're burning as your blood roils in your body
- >A: Go ahead and kill me! I'll take you to my grave!
- >The image of Luna in your mind is suddenly buried under a mountain of dirt and stone
- >You can feel her fear of being buried alive
- >You smile for the moment before the pain causes you to blackout
- >Be Rainbow Dash
- >You gasp and choke as you paw at your sore neck
- >What was that all about?
- >He was trying to choke you to death!
- >That look in his eyes was like an animal about to rend it's food
- >You shutter once and look at his still body
- >What caused him to fall over like that?
- >You move to him with extreme caution and poke his side with a hoof
- >No response
- RD: H-hey, Anon? Anonymous?
- >His body lies motionless on the cool ground
- RD: Oh, man... this is crazy...
- >You don't know what to do
- >He tried to kill you!
- >But, now he might be dead?
- >You place a hoof near his mouth and feel the faintest bit of cool breath
- >You think that means he's alive... or somewhat alive
- RD: Anonymous... come on! Get up!
- >You got to get somep0ny
- >You race to a nearby shop that is just closing down
- RD: Somep0ny! Anyp0ny! Call the ambulance! Human down!
- >The owner looks at you quickly before catching on
- >It's only moments before he is on the phone
- >Minutes pass before you hear the siren of the ambulance approach
- >Two ponies step out and rush to Anon's body
- EMT: You there! Are you alright?
- >One of them looks over your face and bruised neck
- EMT: Were you attacked, ma'am?
- RD: Ah... yes, but they got away... you gotta fix that guy over there!
- >The other worker begins filling a syringe with something and injects Anon in the shoulder
- EMT: Looks like he suffered an acute heart attack. Stand back...
- >The worker's horn lights up for a moment
- EMT: Clear!
- >A bolt of electric strikes Anonymous
- >His body jumps a bit before returning to position
- EMT: Don't you die on me, pal!
- >Another charge of the worker's horn zaps Anonymous
- >This time, you see his fingers twitch and he takes a deep breath
- >He sits up and coughs a bit
- A: Ah... what the hell... I'm alive?
- >The first medic nods to you and then to his friend
- EMT: How are you feeling?
- A: Like I was woken from a fine sleep...
- EMT: Eh, that'll do... how many hooves am I holding up?
- A: Uh... one?
- EMT: Good... OK, I think this one's going to be alright. Do you want to go to the hospital?
- A: No, I'll shake it off
- >The workers shrug
- EMT: Suit yourself, buddy. We can drive you to your house, if you want?
- >You see Anon exchange dialogue with the workers
- >They help him into the vehicle
- >Another approaches you
- EMT: Ma'am, I'd call the local authorities and tell them everything you saw and who attacked you. I'd stay in the air if your assailant wasn't a pegasus
- >He waves and leaves
- >You fly up onto a nearby roof and sit on the edge
- RD: That was crazy... Anon tried to kill me and then almost died trying! What came over him? I need to go find Applejack and ask her what's up
- >You flutter up and take off in the direction of Sweet Apple Acres
- >You just hope Applejack's still awake this late at night
- >A feeling of dread consumes you as you think about how absurd the last twenty minutes have been
- >You just hope it will be more normal at Applejack's place
- >Well, only one way to find out!
- ------------------------------------------------------------------------------
- >Day Settle Down, Pony Up in Equestria
- >Be Rainbow Dash
- >You are the blue blur and fastest flier in all of Ponyville
- >You are heading over to Applejack's farm to find out what is Anon's deal
- >It takes minutes at best with your speed to reach Sweet Apple Acres
- >You search over the fields before spying an orange shape on a grassy hill beside a tree
- >No doubt, that is Applejack!
- >You zoom down to the earth and land perfectly beside her
- RD: Hey, Applejack, how's it..!
- >You hear the sound of sobbing and cut your greeting short
- >Your look upon Applejack with swollen red eyes and a messy mane
- RD: Apple... Jack? Is everything alright?
- >She sniffles and looks to you
- A: Wadda ya' want now, Rainbow? Can't ya' see Ah wanna be alone?
- RD: Oh, um... I was just coming over to ask what's up with you and... um, you know
- >You can't pull yourself to finish the sentence
- >Applejack sniffles before her mouth curls into an angry dribble
- AJ: Yew of all ponies ought to know! Why'd ya' have ta' steal anotha' one from me, Rainbow? Why?
- RD: AJ, I didn't...
- >She shoves you back quickly and returns to her sulking
- AJ: Ya' did! Ya' always do this! Every time Ah get a stallion ta' mahself, ya' steal 'em away... Ah jus' thought ya' wouldn't do it this time if'n Ah had a human...
- >You shake your head quickly
- >You don't always steal her colt-friends away!
- >She's overreacting
- RD: Applejack, I would -never- steal anyp0ny from you!
- AJ: Ya' did that time when we were in grade school!
- RD: That was a little crush, not a full blown relationship!
- AJ: What 'bout that pegasi with the hoofball cutie mark?
- RD: He was totally into me from the start! You don't even like hoofball!
- AJ: Yer jus' too selfish for yer own good, Dash... Ah can't take no more of it
- >She stands to her hooves and starts to walk away
- >You can see tears glisten on the grass as she passes
- >You fly slightly overhead in an effort to speak
- RD: AJ, I didn't steal Anon from you! I didn't even -see- him until tonight and...
- >You rub a hoof against your neck
- RD: ... He was acting a little strange
- AJ: Ya' told me all 'bout yer lil' romp in the hay with Anon... Ya'll jus' keep at it until he don't need me no more
- RD: No, I'm serious! I didn't steal him! I even tried... a little bit
- >You chuckle nervously
- RD: -But-, I didn't! He doesn't even like me! ... He... he doesn't even like me?
- >Applejack continues to walk ahead as you flutter in place
- RD: Anon... doesn't like -me-?
- >You rub your neck again as AJ disappears into the darkness
- >You gently touch down and sit on your back hooves
- >The pain in your neck stings a little more than before as you reflect>On the edge of Ponyville
- >Be Anonymous the vulnerable
- >Your trip back home goes fairly well and the voices in your head are quiet
- >You smile wickedly as you imagine they will stay quiet for some time longer
- >The feeling of a soft neck in your grip echoes its dark memory in your mind
- >What cruel derangement took over you at that very moment, you cannot say
- >You blink the sleeping spots from you eyes as you consider what will happen next
- A: Will Dash hate me now?
- >You stare at your chest to see the marks sitting idly
- >You stare intently at the large apple marking and sigh
- A: Friends... for now
- >A feeling of sadness overcomes you, but you suppress it
- >The streets are fairly empty in this section of town
- >The only light you can see is on from your own home
- >It is like a beacon of safety calling out to you
- >You reach for the handle and easily open your door
- >The smell of cooked food hits your nose as you step through
- F: Oh, Anon! I baked some food while you were gone! I hope you don't mind...
- >You take a seat at your small table and muse over the scent
- >Fluttershy quickly presents you with a plate of exquisite looking fish, corn and a nice slice of bread
- F: I... I know you like meat... all I had was fish on hoof... you know, for my bear friends
- >You look to her and her teal eyes shine with a nervous optimism
- A: It's lovely, Flutters... thanks
- >She smiles as she floats on her wings
- F: I promise that there's no tranquilizers in it either
- >She smiles a little creepier than you feel was needed
- >You take a bite carefully and try to feel around for anything odd
- >The sensation of such lavish protein in your mouth again is delightful
- >Within moments, your plate is bare and your stomach groans happily
- A: Ah, I need that
- F: How was today, Anon?
- A: It was... whatever... I don't want to talk about it. I think I'm going to sleep
- F: Oh, OK, that's fine
- >Fluttershy looks around for a moment before turning to you
- F: Is Applejack here tonight?
- A: Applejack is... not coming over....
- >Fluttershy reads your words carefully before speaking
- F: Did... did something happen today? You know you can tell me anything, Anon. I'm always open for listening
- >You bite your lip and look at her face
- >She has a sincerity that lulls your emotional rage
- A: We... we had an argument... well, she had an argument, I just listened. I don't know if I'll be seeing her any time soon
- >You rest your elbows on the table and cup your face in your hands
- >The darkness feels soothing to your eyes
- >As you sigh deeply, a hoof presses on your back
- F: There, there, Anonymous... if anyp0ny deserves a special somep0ny, it's you
- A: I wish it were so simple
- F: Well, maybe Applejack will come around... Oh, but if you both need your own space, that's just fine too. Sometimes, two ponies need to spend some time to themselves to figure out how much they need each other
- >Fluttershy begins rubbing your shoulders
- >It feels better than you'd imagine
- >You allow her to knead your back for a while as you really do need to relax
- >It's not so bad, or at least, you know it will get better
- >Things always get better... eventually
- A: Thank you for all of this... I didn't realize how badly I needed to come home to a friend
- F: Oh, I am so glad you said that! It means so much to me
- >You feel Fluttershy wrap her hooves around your back and slide her hooves under your arms
- >She hugs you closely for a very long minute
- >Her head nuzzles the back of your own and her mane falls loosely over your shoulder
- >Fluttershy's warmth is comforting
- >Eventually, you do stand up and separate yourself
- A: I'm going to bed shortly. Think I'll have a quick bath first
- >She looks up at you quickly
- F: Oh, do you want me to draw the water?
- A: No, no... I can take care of that myself. Did you get a bath in since you've been over?
- F: Not yet, but I could probably use one after all the hard work I did today
- >She ducks her head a bit and hides her face in her mane
- F: B-but, well... I can't really wash myself too well... not that I'm asking you! I can just go to the spa tomorrow!
- >She chuckles nervously and her eyes begin to water
- A: Fluttershy... lets give you a bath. You've earned it
- >She doesn't protest further, instead wearing a nervous smile
- >You reach your bathing room and set the tub with warm water
- >You dip your fingers in a few times to make sure it is just right before offering Fluttershy
- >She carefully climbs into the tub without causing so much as a ripple of water
- F: T-thank you again, Anon...
- >She shakes lightly in the tub
- A: Is it too cold for you?
- F: No! I mean... no, i-it's just fine! He he...
- A: Alright, let us start then
- >You take a wiry brush and run it over her coat
- >Fluttershy leans into you as you work her fur clean
- >You carefully wash her body down and under her wings
- >Every so often, Fluttershy would let go a sigh or gasp
- >You ignore her for the most part
- >This is strictly business tonight
- >You come to her backside and decide how best to approach
- >It's not really bathing if you don't clean her whole body
- >An idea sparks in your mind
- A: Fluttershy... can you tell me about the Summer Sun Festival?
- F: Y-yes, of course, Anon
- >You reach for her back leg and run the brush down her flank
- F: Ohh~! A-Anon, be c-careful with...
- A: I would really like to know about the festival, if you would?
- F: Y-yes... the f-festival begins on the...
- >You run the brush and your hand along her inner thigh quickly
- F: Begins... on... ahh~
- >Your hand runs a soapy lather over her belly
- F: B-b-b... first sunrise... ahh~! First sunrise before the second h-h-harvest!
- >Fluttershy moans as you pass her smooth stomach and small teats
- >You quickly rinse her off as she attempts to finish
- F: I-it's a... celebration~! For t-the Princess! Ohh~ Celestia! I-it's when the s-s-sun~ is highest in t-the, ohh~ heavens!
- >You finally finish up her most delicate parts and rinse her down
- >She pants quickly as her eyes roll
- F: We all love... the Summer Sun Festival...
- >Her face sinks with her body just under the water as she moans and bubbles
- >Not too much later, you buff her out with a towel and scoot her along
- A: I'll be out in a few... just make yourself comfortable
- F: I will, Anon. Thank you for everything!
- >She leaves the bathroom with a little skip in her step
- >Mares...
- >You smirk and proceed to tidy up
- >It doesn't take long until you step out of the bathroom with steam billowing around you
- A: Ah, just what the doctor prescribed
- >You coo happily as the contrasting cool air of your home begins to take you over
- >You make it to your room to find a yellow lump laying on a more-than-neat bed
- >It is almost impressive to say that your bed looks like Rarity's, but it raises a few questions
- A: ButterThighs... why are you in my room?
- F: Oh, I cleaned up a bit for you. I thought you'd like a nice fresh blanket to sleep on
- A: I appreciate the thought
- >You smile and quickly turn it into a frown
- A: Now, get out, I need to get dressed and you need to sleep on the couch as usual
- F: I... I don't want to
- >Fluttershy shakes as she definitely whispers at you
- A: Why not?
- F: I kind of want to spend the night with you...
- A: Flutters, we are friends, not lovers. I thought I went over this with you?
- F: Well... you did, but that was before... it's different now, right? Applejack won't be around for a while, right?
- >You narrow your eyes at her
- F: I'm not asking for... you know, -that-! I just don't think you should sleep by yourself... because it's better to sleep next to somep0ny, yeah?
- A: You're really going to keep this up, aren't you?
- >She blushed and wraps her hooves around her back
- F: M-maybe just a little while longer. I could be Applejack tonight... she doesn't have to know
- >You sigh a heavy, agitated sigh
- A: You can sleep on the couch as our agreement was and we can continue to be friends without further interruption. Unless you -don't- want to take me up on my infinite kindness...
- >Fluttershy hovers over to you
- F: No, no! I -am- your friend! I promise! If you really want me to sleep on the couch, I will
- A: Thank you
- F: Can I just watch you get dressed?
- A: Fluttershiggy...
- F: I'll cover one eye, like this, OK?
- >She places a hoof over her eye and smiles
- A: Shutterfly...
- F: OK, OK, how about if I cover both of my eyes and just peak occasionally
- A: Get on the couch, you closet case!
- >Your swift roar sends her bolting from your bedroom and you hear a thud on the couch in the living room
- A: Jeez... if you a give a pony a bath...
- >You love that book
- >You quickly get dressed in your bed clothing and lock your door and shutters
- >Can never be too careful when rapists have wings
- A: What did I do to deserve this fate?
- >You gripe to yourself before hearing a slight squeaking noise from against your wall
- >You listen closely to hear the moans of Fluttershy
- >Masturbating on your couch again, nothing too new for her
- >For one reason or another, you don't mind it all too much and fall asleep rather quickly
- >Tomorrow will be better, you whisper in your head
- >Your woes and worries fade as you drift off to sleep
- >In a castle on a mountainside
- >Be Princess Celestia
- >You yawn as you relax your powers for a while
- >It is so good to have Luna around again
- >Your horn feels hot from the repetitive task of moving the sun, but the night gives you some respite
- >You retire to your bed chambers with a groggy smile playing easily on your muzzle
- >As you walk down the hallway, a faint sounds catches your attention
- >It sounds like somep0ny crying, but you cannot imagine who
- >The sound leads you down a turn and ends on the other side of Luna's own bed chambers
- >You carefully open her door and peer inside
- >Your sister is under her blankets, crying with urgency that you cannot ignore
- C: Luna? Dear Luna, what is the matter?
- >You slowly walk to her bed
- L: Oh, sister! Do not come closer. I do not want you to see me like this!
- >Her sobs grow ever desperate as Luna gasps for breath
- C: What has happened to cause you such pain?
- L: It's... it's nothing! I had a nightmare...
- C: -You- had a -nightmare-? Tell me what could frighten you so badly
- L: I was... It was... it was awful!
- >Luna cries loudly and crawls to one side of her mattress
- C: Please, tell me what is wrong! I want to help you!
- >You hear choking and mumbling through sopping tears
- L: I... I was watching the human subject... I was making sure he stayed in his place...
- >You sit at one edge of her bed and listen
- L: He... oh, sister... I have never felt so much anger and rage since my season as Night Mare Moon. It was terrifying!
- C: You were caught this way in a dream of his?
- L: Yes, a partial dream...
- C: My, my, that is no good. What brought about these emotions in him?
- L: He believes I am to blame for his affairs. He has become smitten to Honesty, but she returns no such affections for him now. He believed it is somehow my fault...
- >Her sobbing fades slightly as she breathes deeply
- C: That is not a good sign... what are his intended actions now?
- >Luna whines through her teeth
- L: I... I don't know... I couldn't reach him through the malice... it was like I was being suffocated
- >You ponder for the moment
- >If Anonymous can move your sister to tears with just his emotional violence, there is no telling what he may be physically capable of
- C: It is decided then, sister...
- L: W-what is?
- C: What we must do...
- L: D-do you mean...?
- C: Yes, I do. We shall visit him tomorrow at dusk. He shall be judged by both the sun and moon as one
- >Luna barely lets go a whimper now as the room grows still
- >You worry if she will be emotionally prepared to confront Anonymous by the next day
- >You really have no choice
- >It has to be this way
- >For better or for worse, but always for your ponies first
- >Always
- >On a dark cloud, circling Ponyville
- >Be Dash the Conflicted
- RD: Anon doesn't like me? But, that's crazy!
- >You roll the cloud between your hooves and press some water out
- RD: What's not to like about -me-? I am -awesome-!
- >You hop to your hooves and stamp the cloud out a few times
- >Rain drizzles lazily out as you curl back into a ball on your belly
- RD: Then why don't I feel awesome right now? Did I really mess up so bad that Anon wanted to hurt me?
- >You think as hard as you can about the current events
- >Ideas and deeper philosophies confound your straight-forward outlook on life, but you come to a realization before too long
- RD: Maybe I have been too hard on Anon... and AJ...
- >You feel like a mule for all of this
- >Starting tomorrow, you will start setting things right!
- >It's kind of late to worry about things now anyways
- >Tomorrow's just going to be another simple day and you'll be able to fix all these problems
- >Yes, ma'am!
- >Just a simple, boring day to work through simple, boring issues
- >You fly from your raincloud as you head home for some rest
- >The sun rises and creeps through every crack and crevice as it works to wake the denizens of Equestria
- >Be a well-rested Anonymous
- >You stretch your limbs and roll out of bed
- >Undoing the locks on your door, you stumble into the hallway then to the bathroom
- >You open the door to see a yellow pony sitting on your toilet
- >Oh, right, Fluttershy slept over
- >A cry catches your attention
- F: Anonymous! Don't you know how to knock?!
- >A roll of bath tissue flies at your head and hits you with its pillowy softness
- >You stumble back into the hallway as you close the door
- A: Sorry! Forgot I had anyone over!
- >You chuckle through the wooded frame
- A: Umm, you want something for breakfast?
- F: T-this is not the time to talk, Anon!
- A: Don't tell me you're embarrassed that I saw you on the toilet! You've put your butt in my face countless times!
- F: This is different! It's weird! I'll be out in a moment!
- >You tap your foot and check your wrist for the time
- >There is still no watch on your wrist
- >Fluttershy appears from her morning routine shortly afterward
- F: I-it might smell funny... maybe you should wait a moment?
- >You don't really care right now, you have to pee so bad
- >You race in on one leg and slide Fluttershy out with the other
- >Sweet, glorious relief!
- >After a splash down the drain and a splash of water to the face, you are ready to seize the day
- >You step into your living room and realize that there is nothing to actually seize
- >Fluttershy is standing by your table
- A: So... what are we doing for breakfast?
- F: Oh, I am not certain. What would you like?
- >You shrug
- A: Anything really. I am honestly not all that hungry after how well you fed me last night
- F: Did you really like dinner that much?
- >Her hooves clasp together as her smile grows on her small muzzle
- A: Without question! I have not had fish in so long and you make a fine meal out of it
- >She blushes and twists in place
- F: Oh, thank you, Anon
- >You run a hand through her mane affectionately
- >Her pink mane is much softer than Applejack's
- >She purrs a bit before you move on to the kitchen
- A: How about waffles?
- F: With blueberries?
- A: Uh... if there are some, sure!
- >You rummage about your tiny refrigerator and find all kinds of fruit
- >All different varieties of fruits save for blueberries
- F: That is fine either way... I just love watching you cook
- >She sighs and her eyes go foggy
- F: A stallion who can cook is pretty rare
- A: What about a stallion with a cooking cutie mark?
- >He attention refocuses on you
- F: Oh? Is that your cutie mark? I've never seen it before
- >She quickly darts to your side and you feel hooves press at the elastic belt on your pajama bottoms
- A: Hey! Keep your hooves above the belt, you!
- >Fluttershy doesn't really let go, but doesn't immediately try to pull your pants down
- F: I am just curious. You never talk about your cutie mark with anyp0ny... Oh, Applejack has probably seen it though, right? What does it look like?
- A: I don't have a cutie mark, Flutters. I thought I told you that before?
- F: No, you haven't, but that's just fine. Sometimes, it takes a long while to find out what you are good at
- A: No, I mean, humans don't get cutie marks
- >You feel a hoof slowly apply pressure to one side and feel your flesh touching cool air
- >You leap to one side and adjust your pants
- A: Stutters... you know better than to try to disrobe me... again
- F: Oh, yes, sorry
- >She laughs nervously as a few beads of sweat build up on her brow
- >Fluttershy steps back and takes a few deep breaths
- F: I'm just... it's just... well...
- A: I understand you still have romantic feelings towards me and, even if I don't want to admit it, I'm not helping your situation
- F: Oh, but you are! You're so sweet and kind and the nicest human I know...
- A: ... Only human you know
- F: That too. If anything, I'm the one taking advantage of your kindness
- A: No, no, by me being so nice, all I am doing is furthering your desires, I think
- >Fluttershy laughs a dainty laugh
- F: Not at all, Anonymous. I think I am getting better just being with you!
- A: I think that's the opposite... have you stopped thinking about me even once since last night?
- F: Of course I did... well... I almost did, but I had a dream about you and me and we were in a huge ice cream bowl and something about chocolate syrup... it's blurry to me now
- A: What about your solo recital last night?
- >You beam slyly at her
- >Fluttershy's face flushes pale and her eyes dilate at your words
- F: Y-you heard me l-last night?
- A: He he, was it suppose to be a secret?
- F: I didn't mean to...
- A: It's fine. Had I really cared about what you were doing to... you, I would have sent you away already
- F: So, you -don't- mind that I, um... I... you know?
- A: Did you clean up the couch? I can't invite guests over if my couch reeks of mare lust
- F: I used a towel...
- >She looks away blushing
- >You stare with more amusement than you thought you could muster
- >You burst into laughter as you finish arranging the table
- F: W-what's so funny?
- A: I never realized how much I would miss your antics until you were gone. Please, sit, food will be ready in a moment
- >You lay a golden waffle onto each plate and have an excellent discussion about the last few weeks
- >Somehow, Fluttershy leads you into talking about your relationship with Applejack
- F: Did you too go on lots of dates?
- A: Hmm... not really. Applejack is much more the type to want to cuddle under the stars. We spent more time on her farm than out gallivanting
- F: Oh, it sounds romantic... I never though Applejack would find time for anything simple. Her life is always hard work
- A: Yes, I do believe my time with her was a small miracle
- >You push a lonely piece of waffle about your plate as your appetite fades
- F: D-did you two... um, -kiss- a lot? I'm just wondering, you don't have to answer if it's too embarrassing...
- >Fluttershy is blushing so vividly that you fear she'll pass out
- A: We kissed perhaps as much as the next couple...
- F: Knowing Applejack... she's so rough... oh, I bet she put her tongue in your mouth and pressed your tongue so hard...
- >She twitches in place a bit
- A: To be honest, I was probably more aggressive. AJ was very shy despite her boisterous display
- F: Oh goodness... do you really love her? Like... like somep0ny you'd want to spend your life with?
- >You grade her words for a moment
- >It takes a long pause before you can answer correctly
- A: I do not think she would want me in that way... I am not even sure if I would want her either
- >Fluttershy's ears ping as if searching for some invisible radio wave
- F: Oh... oh! So, so you think you should try some -other- ponies first?
- >She looks at you with large, hopeful eyes
- >You and your big mouth
- A: I don't think I am ready to jump into another relationship just yet. I have a wound that needs time to heal
- F: Oh? Did you get hurt while working with Applejack?
- A: No, no... a metaphorical wound... on my metaphorical heart
- >She covers her mouth with her hoof as her eyes fall into sadness
- F: That sounds like you need a friend more than ever
- >She smiles to you and crosses her chest with both hooves
- >You look upon her and wonder where she hides her innocence
- F: I am happy to be here for you, Anon. You're really a good friend
- A: Thank you and... you too
- >You clean up in a state of somber quietness as your mind races with memories of what once was
- >You recall Applejack's sweaty body after a hard day's work resting against your own worn self
- >You can picture her emerald eyes staring up at you, staring into you
- >Her mouth drawing closely to your own as her hot breath washes over your lips
- >Slowly, soft lips snare you, embrace you and you surrender so willingly
- >The feeling of pure bliss absorbs your very being
- >You feel a hoof on your back and turn around quickly
- A: Apple~...
- >In your sight is a yellow mare with a pink mane
- >Your breath sinks for but a moment as your fantasy is shattered
- >You feel like a scoundrel of the lowest pit while you wish the mare before you was another
- F: Apple?
- >You stare for the moment before trying to cover your own foolishness
- A: Apples! Yes, delicious apples! Would you mind fetching me one from the bowl in the living room?
- >She smiles before fluttering away
- >You feel awful for the moment and pray to your varies deities that Fluttershy didn't take notice
- >A sharp sound rings out in your head and you hold your temple in agony
- >C: Hello, human called Anonymous! You are receiving this message to inform you that you shall be visited by Princess Luna and myself today at dusk! Be ready at your home, we have much to discuss! Thank you and have a nice day!
- >An echo of the first sharp sound splits through your head and causes you to lose your balance
- >Fluttershy flies in with an apple in her hoof before spying your body on the fall
- >She rushes to you and tries her best to lift you
- F: Anon! What happened? Are you OK!?
- A: Yeah... yes, I'm fine. I think we'll be having guests a little later on
- >She looks to you with a hint of confusion on her face, but dismisses it
- >You stand to your feet and continue on about the day
- F: So... what is it you do when nop0ny is around?
- A: I... I, um... go out and look for something to do
- F: Oh, OK. I have some shopping to do if you want to come along today?
- >You shrug
- A: Why not? I need to pick up some vegetables at any rate
- >You both head out to the farmer's market
- >As you walk, you look to the sky
- >The sun is nearly at its peak and you estimate that it will be twelve noon
- >You contemplate the benefits of buying a watch despite knowing that you will never go through with it
- F: Hey, Anonymous... do you like hay fries?
- A: Tried it... didn't care too much for them. Why do you ask?
- F: Oh, no reason... do you like pumpkin flowers?
- A: Yes, with egg when I can get it. I also like many types of sweets, Pinkie's special batches are always the best, as well as nearly every vegetable except for rhubarb
- F: Oh, do you like rhubarb when it's a fruit?
- >You nod solemnly
- A: Now, did that satisfy your curiosity?
- F: No... not even a bit
- >You chuckle to yourself
- >You know she just trying to make small talk and it is nice to see it has nothing to do about your fetishes
- >Unless this is about if you have a food fetish, but that is ridiculous
- >After more chatter and walking, you finally come upon the market grounds
- >Colourful tents and stalls line either end
- >You jingle a pocket full of coins happily as you imagine all the nice things you'll be able to get make for dinner
- >Fluttershy scampers about as she looks for what she needs
- >You see her speaking with a sales clerk and wonder to another, more interesting booth
- >Before you realize, you are in an area dedicated to all manners of apples
- >The scent, the colours, the unreal barrels upon barrels filled to bursting with apples captivates you, if only for the moment
- >Suddenly, a familiar face appears from behind the stall with a large smile and a welcoming hoof
- AJ: Well, howdy, customer! What can Ah do ya' fer?
- >Your eyes meet Applejack's and you both stare silently for a moment
- >Her smile slowly fades into a look of grand indifference
- AJ: Oh... hey, Anon...
- >She paws at the back of her neck and looks away
- AJ: Ya' here to, ah... by some apples?
- A: I... I'd like to, yes... do you have any, um... golden delicious?
- AJ: Ya' know we do...
- >She moves from behind the stall to a barrel and points
- A: Oh... good... because, you know, it's not easy to find that particular apple. I was saying to myself the other day-
- >Applejack cuts you off with her dry tone
- AJ: Two bits a piece
- A: Oh, oh right...
- >You pick out two and lay four bits down
- A: So...
- >You smile as best you can as you lean over the counter
- AJ: So...
- A: Applejack, can we please talk?
- AJ: Thank ya' fer choosin' Sweet Apple Acres brand apples, come again soon
- A: Please, I just need to tell you-
- AJ: Anonymous... please, ya' did enough already. Jus'...
- >Applejack tilts her head part way to hide her eyes
- AJ: Jus' go on. Take yer apples an' git!
- >You are dishearten as you turn to leave
- >The only sound you hear is Applejack's muffled sobbing
- >Don't look back
- >Just do what she asked
- >You wander back into the crowd and look for Fluttershy
- >It doesn't take long to find her at a tent selling blueberries
- >She beams as she lays down twice as much as you think she should pay
- >Sometimes, she is such a doormat
- A: Flutters, how goes the shopping?
- F: Oh, I'm all done. Did you get everything you need?
- >You brandish an apple and toss her the other
- >She catches it expertly in her mouth and bites into it
- >Juice drizzles down her maw and you hear the crunch of sweet apple flesh between strong jaws
- F: Mmm, tith ith good!
- A: Yes... they always are...
- >You feel like the world is conspiring against you as you tuck the apple into a coat pocket
- >Fluttershy swallows loudly and sighs
- F: That was so good. Thank you, Anon
- A: Don't mention it...
- F: You look blue again... what's the matter?
- A: Have you ever heard the saying, "If you love someone, set them free?"
- F: I have, actually, but you didn't finish. "If they return, they're yours forever"
- >You walk a little way ahead of Fluttershy before the words sink in
- >You can feel your chest rattling as tears flow freely down your cheeks
- F: Anon? Anonymous? Is everything alright?
- A: It's great...
- >Your voice cracks through your sobbing
- A: Never better! Lets get home...
- >Fluttershy is at your side and you see her face looking up to you
- >You try to hide your weakness like you always do
- F: Anon... I know it must hurt you
- A: I've never felt better!
- F: It's not your fault, Anon
- A: Of course not! I did all I could do
- F: It's -not- your fault
- A: Everything is fine! I'm fine!
- >Fluttershy stops in front of you
- >She floats up and presses her muzzle into your face
- F: Anonymous! It's not your fault!
- >You freeze
- >You can no longer lie with those eyes staring at you
- >Tears stream from you and you feel your nose run
- >There is no hiding now
- >You quickly wrap yourself around Fluttershy and cry into her soft furred shoulder
- A: It hurts so much! She won't listen to me! She won't even give me the time of day!
- >Fluttershy pats your back
- F: There, there... you're not a cold, callous human. You just have mixed feelings
- >She pushes you just slightly from her so that she can speak directly at you
- >You sniffle and imagine you look like a mess of red eyes and curled lips
- F: You know what? You have spent the whole day thinking about Applejack and not spending anytime for yourself! Lets get you some, "You time", OK?
- >You just nod like a child as the motherly Fluttershy speaks incredibly wise words
- >She leads you by the hand to a store not too far down the road
- >You enter in and are greeted by twin ponies with pink or blue coats and likewise manes
- F: Hello, girls
- Aloe: Fluttershy! How are you? Where's you're, "partner in crime?"
- >She giggles and makes air quotes
- F: Rarity isn't here today. In fact, I didn't come today for myself either. My friend, Anon here, needs to relax and refresh himself
- >The twin ponies look to each other hesitantly
- Aloe: I... I suppose we can work something out. Right, Lotus?
- >The other pony simply nods and steps into a back room
- F: Oh, thank you so much. I know you are so busy
- Aloe: For you, Fluttershy, we will make time
- >She winks makes a strange gesture that must mean something to Fluttershy
- F: Hah, well, yeah, thanks
- >Fluttershy ducks out a little and tries to conceal her embarrassed face
- >Before you know, the twin ponies are pulling you into the back rooms
- >It is much bigger than you would have imagined from the outside
- >You are sat down at a small chair and your coat is taken from you
- Aloe: Ok, now... we will begin with a facial. Can you... take off your mask?
- >You look at the errant horse with scorn
- A: No
- Aloe: I... OK, alright... um, you don't have hooves, do you?
- >You shake your head to confirm her suspicion
- >You feel the other pony at your feet as she removes your shoes
- >She slips off one black sock to reveal your foot
- >Both of the twins look down to you bare foot and gawk bemusedly
- Aloe: Wow, OK... this is going to be tough... is that like... an oblong hoof?
- A: It's a foot, it has five nails. I have calluses on the outer side due to my way of walking... you girls really don't have to worry so much about this "relaxing" idea
- >They look at each other before the second pony with the blue coat speaks
- Lotus: I zink I can do zis, actually! I took a year of veterinarian school!
- >You are slightly insulted by that remark and slightly interested to find Polish ponies
- >It raises a great deal of questions you don't have time for
- >You feel a sponge at your foot and twitch a bit
- >The gentle scrubbing makes you a bit ticklish
- >You next feel a file at you nails and a rough scrubbing pad at your callused soles
- >As the twins work, you ponder how difficult this job must be for ponies as they need to use their mouth to hold their tools while smelly hooves press in their muzzles all day
- >Maybe they've built a tolerance to it all?
- Aloe: All done, lets move you to a table next
- >You stand up to find your feet feeling incredibly light and comfortable
- >The smooth, stone floor feels so real under your weight now and you admire the expert craftsmanship with each delicate step
- >You lay down on a short blue table with your legs hanging a good distance off
- >The twins bring in a second table for your legs, however, you feet still dangle
- Lotus: Wee'll be needing you to remove your shurt, please?
- >You do so with great caution yet you are unsure why you are so worried
- >Having disrobed, you are instructed to lay on your belly and relax
- >You feel four soft hooves begin to work into your sides and back
- >In no time, you feel like putty at their expert ministrations
- >Who knew letting a pony touch you would involve in you being relaxed?
- >Usually, this part would involve you struggling against a would-be assailant
- >For now, you just enjoy the massage
- >After a glorious time of undetermined length, the twins have you move to yet another room
- Aloe: If you could, um... take off your pants?
- >She smiles and looks nervously
- >This time, you get the idea and strip down in private
- >A towel adorns your waist and keeps you mostly decent
- A: I've been in a sauna before... sweating should do me some justice!
- >You close the door and wait in the currently cool room
- >A moment later, the blue mane pony trots in with a small pail of coals and a match stick
- >She lights the fire and adds a little water to start the steam
- >You recline on the wooden bench as the room begins to warm up
- >Another body enters the room
- >To your surprise, but possibly not too surprised, a familiar yellow mare is standing in the doorway
- >She skips happily along with a towel on her head and sits beside you
- F: Hey, Anon! Are you enjoying your spa time? Are the girls being friendly with you?
- A: Yes, everything is lovely. Thank you for this suggestion. I had no idea a bathhouse was even in this town
- F: Think nothing of it! I am happy I could help
- >She casually snuggles up against you
- >The spa worker lets go a small gasp at the sight, but smiles lightly
- A: Fluttershy... it's hot
- F: So hot~
- A: You're going to make me smell like pony sweat
- F: Mmm, yeah
- >She giggles vacantly
- >You think of pushing her to one side, but can't find the heart to do it
- >It was all her idea and it has certainly given you time to clear your head
- >You let her have her moment
- >The pink coat mare adds another ladle of water and steam begins to thicken in the room
- Aloe: I see why Rarity didn't make this trip with you
- >She giggles a bit and bounces her eyes
- F: Oh, this was a spur of the moment thing. Anonymous here needed some time to just relax. He's always so busy and hardworking
- >She gives you far too much credit
- >You run a hand down her back as she continues
- F: When I am really frustrated or confused, I find a good bath helps me think straight. Sometimes, working all week with my animal friends is exhausting too
- Aloe: Oh, is this a business trip then?
- >The spa worker has a genuine look on her face
- F: What do you mean?
- Aloe: Is... are you taking care of this -one- as well?
- >She points a hoof at you
- >You are mildly offended, but only mildly
- >The other ponies in town really don't know you and it's natural for you to assume they would be confused at the best and xenophobic at the worst
- F: Oh, heavens no! Anon is a friend. He's a human, which is not too different than a pony. He's really very nice once you get to know him
- >Fluttershy pats your side with a little smile on her face
- Aloe: Oh... I see... well, good to meet you... Anonymous, was it? I'm Aloe
- A: Yes, good to meet you as well...
- >You two stare at each other for a moment before parting
- >Back to relaxing
- >You feel a fuzzy nose press close to your ear as Fluttershy whispers
- F: Hey, Anon... thanks for letting me sit so close. Your skin feels nice
- >You feel a small peck on your cheek
- >Fluttershy rests beside you again with a little blush on her face
- >Aloe doesn't seem to notice you two
- >After a bit more sweating and an excessive amount of removing Fluttershy's hoof from your lap, you finish up
- >You stand to your wobbly legs and stride out of the steam room
- >Your muscles feel incredible as the cool air embraces you
- F: Ah, nothing like a good steam to loosen up your tired wings
- >She stretches forward and spreads her wings fully
- Aloe: Did you want to finish with a rinse?
- >Fluttershy nods with a smile
- F: Oh, yes, that would be lovely
- A: I suppose so, sure
- >Aloe leads you to a simple room with shower heads jutting from the wall, not unlike a gymnasium shower, albeit much cleaner
- >You step in only to find Fluttershy standing beside you
- >She smiles absently before removing her towel on her mane
- >The pink strands of clean hair lay against her head in neat rows
- >She looks much more mature with her hair slicked down in this way
- A: Oh, I'll just... step out and wait for you...
- Aloe: Is something wrong?
- A: What? Oh, no, nothing at all. I'll be waiting for Flutters to finish
- >She looks at you curiously
- Aloe: Alright, if you want to wait out in the hallway
- >Fluttershy looks slightly defeated as you begin to walk away
- >You hear her about to speak and turn quickly to face her
- >Possibly, you turn too quickly and slide off one foot
- >You catch yourself with all the grace of a bag of flour
- >On the plus side, no concussion
- >On the negative, you lose your towel
- >You stand halfway to attempt to cover your manhood and scramble for your towel
- Aloe: My goodness! Are you alright?
- A: Yes, I just... hand me the towel!
- >You cover most of yourself with one hand, but gravity states that any object in motion will stay in such a way
- >Aloe suddenly catches a glimpse of your member
- Aloe: Oh... so you're a male... that makes a little more sense
- >She laughs a bit before actually handing you the towel
- F: He really is~
- >Fluttershy appears to drool a little as her eyes narrow in on your form
- A: Yes, yes, enough! Just...
- Aloe: Well, this can be coed if you two are so close... there is no real rule on our establishment. We do ask that you keep any Hanky-Panky business out of this shower though. We really can't afford to keep, ugh... irrigating the drainage system
- >The pink mare places a hoof to her eyes and sighs deeply
- A: No, it's not what you think! We're just friends!
- Aloe: That's how it always starts, darling. You two enjoy yourself... but, not too much. Stupid narrow sewer pipes...
- >She walks off and closes the door behind her
- >You are left semi-nude in a shower with Fluttershy
- >It is a good thing she has changed enough that you don't have to-
- >Wait a tick
- >A fuzzy kind of something rubs past one of your hanging orbs
- >You quickly pull away to see Fluttershy sniffing at you
- A: ButterThighs!
- F: Sorry! Sorry, you were just standing there...
- A: You know better!
- F: I do, you're right
- >She smiles and her nostrils dilate slightly
- A: I am really not comfortable showering near you
- F: Can I help you wash off? I'll be really gentle, I promise
- >Her eyes are wide with hope, but not as wide as her back legs are stretched
- >You carefully walk to one side of the shower with a scowl on your face
- F: So... that's a, "no", huh?
- A: Yes
- F: Oh, it's a, "yes?"
- A: No, I mean, "yes", it's a, "no"
- F: So... so, you want me to help your bathe?
- A: No! I don't want that! I can do it myself
- F: But, I have a luffa?
- >You just stare vacantly as this persistent mare
- >Where -did- she get a luffa from, you will never know
- >You quickly rinse off and wrap the towel around you
- >To Fluttershy's credit, she only peaks at you eleven times
- >You walk off into the hallway and see your clothes are neatly hung up on a metal rack
- L: Humans... we never couvered zat in class. I'm adding zis to my résumé!
- >She smiles and you can't help but return the sentiment
- >Other ponies aren't so bad, you think
- >You head out of the spa feeling rejuvenated and ready to take on your impeding guests
- >Fluttershy walks easily beside you with a large grin on her delighted face
- F: So, Anon, which guests are you expecting today?
- A: At the least, Princess Luna...
- >She freezes in her tracks
- F: L-Luna!? The Princess!? What is she coming over for?
- A: I am not entirely sure, but hopefully, nothing too important
- F: Oh my, does my mane look alright? We should cook something for her! Princess Luna likes tea with honey!
- A: Calm down now, Flutters... I am sure it won't be too pleasant of a stay
- >She rambles on about the different things we should do when you arrive home
- >You barely pay her any mind as you wonder just what the Princess intends to do to you
- >Up until now, you've had a pretty standard day
- >Dare you admit, today was above average!
- >You even feel a slight tingle on your breast as the butterfly symbol on your chest has been steadily growing all day
- >You must say that today was a good day and you could only wish for so many more
- >The sun hangs on the horizon for the moment and your shadows are cast long across the dirt roads
- >Time has been moving very slowly, almost with purpose today, since you received the message
- >You do not fear the Princesses arrival
- >It's almost as if you have accepted how inevitable it was; as if Death itself was creeping upon you and this was just in the grand scheme of the cosmos
- >The two of you arrive at your home as the sun sinks just under a lazily drifting cloud
- >The purple and pink shadows in the sky look as much as dusk to you as ever before
- >You do not enter you home, rather, you sit on your doorstep and watch the clouds
- >Fluttershy sits beside you and you wrap one arm about her waist
- A: Fluttershy...
- F: Yes, Anon?
- A: Did you ever feel like you truly belonged?
- F: I... I don't know exactly what you mean
- A: I mean... have you ever felt that you were part of this grand sum of parts, that without you, there would be no functioning whole?
- F: I... I think maybe once or twice...
- >She seems to try to wriggle from your grasp as you hold her steadfast
- A: I've never really had such a feeling... I always feel out of space. Not just in Ponyville, but everywhere I have been
- F: Well, you don't have to worry about that now. I'm your friend and I am sure a lot of other ponies would be your friend too if you give them the chance
- >You entertain the notion for a while as you stare into the fading sunlight
- A: Perhaps you are right... I also want to thank you
- F: Oh, you don't have to thank me
- A: Yes, I must... you helped me today in a way I never imagined... you gave my spirit a chance to be happy again. I am sorry for the wrongs I may have brought you and I forgive you for all you've done to me
- F: A-Anon, why are you talking like that? What's wrong?
- A: I am just reflecting...
- >Fluttershy looks at you with shaky eyes
- F: Are you... are you going somewhere?
- A: Not that I know of yet, but perhaps
- >She holds you tighter as your own uncertainty causes her to quiver
- >You sit in silence as the pink swirls dance across the skyline
- >How beautiful the clouds are today, you think
- >A sudden chiming noise rings in your ears and snaps you to
- >You can see on the horizon a golden chariot racing towards your location
- >Within an instant, the princess of the sun and moon are upon you
- >You simply sigh as they land and approach you
- C: Anonymous the human! I am Princess Celestia, ruler of Equestria and I have summoned you here today due to reports from Princess Luna
- >She gestures a hoof towards Luna who cringes as you make eye contact
- C: It has come to my attention that you are harboring a great anger within you. This cannot be if we are to maintain peace and harmony. Do you understand the seriousness of this situation?
- >You look at her with hollow eyes and nod
- A: I do...
- C: Then you will understand when I tell you that a change is necessary?
- A: I will...
- C: Luna, to my side! I will need all of your power in order to make this possible
- L: Sister, maybe we should... we should wait?
- C: Dear sister! Surely, you of all ponies can feel the hatred in this humans heart! Even being in his presents is enough to make me feel uneasy
- L: I just... I don't know... I don't know if this is the right thing to do
- C: You are still young, dear Luna. Remember that the right thing is not always the easy thing
- L: Sister, I...
- C: Now... lend me your magic, Luna
- >Fluttershy holds you tightly as the Princesses argue
- >She whispers to you through shaking lips
- F: What are you they talking about? What did you do?
- A: I betrayed a friend...
- >You are interrupted as Celestia takes the floor again
- C: Anonymous the human... it is unfortunate that we must do this, but we are concerned for the fate of Equestria and for every little pony we are tasked to protect. We have watched you for a long time and this call is not something that has been easy for either of us
- F: P-Princess Celestia, if I may, what is happening? What did Anon do?
- C: Little Kindness, ever the vigilant keeper of your friend's wellbeing. It would be fitting for you to be here this day. Anonymous has exhibited signs of being the returning darkness that my sister and I banished decades ago
- F: But, that can't be true... Anonymous is the nicest, gentlest, most caring human I know
- C: While he has the ability to be kind and harmonious, he also has the power to unleash great disruption amongst this land. We would never want to see you or any other pony hurt
- >You place a hand on Fluttershy's back and glide your fingers down her soft fur
- A: Fluttershy... I want you to know that you are my very best friend. I think the Princess is right, though... sometimes, you need to do what is best for the many
- >Luna looks at Celestia with sad eyes and turns her head from you
- >You see Celestia take her sister closely against her and hold her tight
- F: I... I don't understand. Why are you punishing Anonymous?
- >Fluttershy holds you tightly and leans her face into you
- >You stroke her mane
- >She feels softer than ever before
- C: Dear Fluttershy, do not worry yourself. Anonymous needs his place in Equestria
- F: He has a place... he has friends! He's a good human!
- >Fluttershy cries into your shoulder now
- >You lift her by her chin and meet eye to eye with her
- A: Don't cry... you know I can't stand to see you sad
- C: You are capable of such great acts of compassion, Anonymous. Surely, it will be your special talent
- Now, Luna... let us do what must be done. For the good of Equestria!
- L: Yes... for the good of Equestria...
- >Two horns come together at the tip and aim towards your chest
- >A bright flash of light strips the binding Luna placed on you so long ago
- >Your chest feels so much lighter suddenly and your mind is clear of voices
- L: You won't need such magic anymore. We have rendered our verdict and now pass judgment... this is... this is for the good of everyp0ny!
- >Luna has tears in her eyes as she brings her horn to you
- >Again, Celestia lays her own horn upon her sister's and they begin to cast a powerful spell
- >You clutch Fluttershy's hoof in your hand
- >Slowly, you are lifted off the ground
- >You lose control of your hand as Fluttershy's hoof slips out
- >There is no sound
- >There is no light
- >There is only the face of one mare who had always been there for you
- >A final pulse of bright light engulfs you before the world goes dark
- >The next morning, the sun stretches out across a beautiful cottage nestled on the edge of Ponyville
- >Be Fluttershy
- >You yawn and stretch as your rise from your slumber
- >The snoozing lump of a stallion is tangled up about you and you carefully remove his hooves from you
- >He rolls over and stares at you with his gorgeous eyes
- A: Good morning, darling
- F: Oh, sorry, did I wake you?
- A: No, I was just about to get up anyways
- >He rubs his nose against your own with a smile on his face
- A: Besides, I promised to make you blueberry waffles this morning
- F: You remembered, how sweet of you
- >You blush a little as he pulls you in close to him
- >His charcoal grey fur mixes so naturally with your yellow coat
- A: We've been married for six years now, how can I forget my sweet-heart's favourite breakfast?
- F: My, has it been that long already? Feels like we just met yesterday
- >You give him a peck on the cheek
- A: Love is crazy like that sometimes
- >You both chuckle lightly as he hops out of bed
- >You look him over and admire his amazing features
- >His strong legs move effortlessly on the wood floor
- >His taut bum sways so seductively as he pushes from one hoof to the other
- >How could you have ever found such a sexy and loving stallion, you'll never know
- >The doorbell rings and snaps you from your trance
- A: I'll get it!
- >You lift off from the bed and follow Anon down the steps
- >He gets to the door first and opens it to reveal Princess Celestia
- >She stands in the doorway with her typical smile spread merrily across her muzzle
- C: Hello, Fluttershy and Anonymous! How are you to this morning?
- >You bow quickly to your Princess
- F: Oh, very fine! What can we do for you this morning?
- C: Nothing, really, I was just passing by and decided to pay a visit to you. I haven't seen you two love birds since the Summer Sun Festival last year!
- F: We have been so busy attending to the animals. There's been another bunny boom since Angel got into Darla's cage
- C: Oh, my! Sounds like you two have your hooves full!
- >Celestia chuckles politely
- C: Well, let me not keep you two from breakfast! Good day, Fluttershy and Anonymous!
- >You both wave Celestia off
- A: How nice! Princess Celestia coming all this way just to see us!
- F: She's always been so kind to us. We should make her an extra special fruit basket for the celebration this year
- A: Absolutely! But, first, I think I need to get a little honey before breakfast
- F: It's on the top shelf next to...
- >Anonymous quickly moves between you and locks his lips to your own
- >You giggle into his forceful kissing
- >How you love this stallion so, only the heavens would ever know
- >He breaks the kiss with a seductive smile
- A: Now that's worth getting up for! Ha ha!
- >Anon sets off to making you his specialty blueberry waffles as you chatter on about the day's work ahead
- >A small distance from the cottage
- >Be Celestia, the Princess of the Sun
- L: So... has the spell taken it's full effect?
- C: I believe so... having spoken to everyp0ny now, none can remember any humans in our lands and certainly do not remember the rifts set between them over a human's love and affection
- L: Good, we have done what was right for our ponies...
- C: Yes, it was a tough decision to rewrite this chapter of time, but we did it for the safety of all equinity. So long as we remain under the sky and above this earth, we are sworn to keep these lands eternally safe. Remember that, sister
- >Luna nods slowly and peers at Fluttershy and Anon as they leave her cottage together
- L: Did... did they get what they had wanted?
- C: I believe so. You seemed very generous to make sure they would be the most happy of the elements
- >You stare at the two as they set out to work with their animals
- >The two nuzzle each other so naturally, you feel it was meant to be
- C: I can't help but notice that Anonymous never developed a cutie mark in his transition. Do you have any idea why?
- >Luna seems quite for a moment as she searches for the right words
- L: A long time ago... somep0ny had told me that humans don't get a cutie mark...
- >You see tears well in your sister's eyes
- L: They just... just learn as much as they can... and h-hope they're good at something
- >Luna's knees shake and she stumbles momentarily
- >You stand beside her and let her lay her weight on you
- L: Oh, sister... what have I done?!
- C: What you had to and nothing more. I have seen your reports and your memories. You will make mistakes and you will learn of their actions and consequences
- >She looks up at you with shock on her face
- C: Anonymous never was, sister, as far as the world is concerned. Applejack never fought with Rainbow Dash and Pinkie never added another birth date to her calendar. Twilight never finished her almanac on the human animal. All these events you had to witness, but time is simply a strand of thread on an infinite loom just waiting to be undone
- L: I... I want you to make me forget it all too! Please, sister? It hurts so badly in my heart to know what I had to do!
- >You look down with the steely eyes of a ruler who has experienced this pain before
- C: No, little sister... the others are spared this pain, but you must learn what it means to wield such power. You must suffer now to see thousands of suns and moons undone in a single evening
- L: But, why, Celestia? Why does it hurt so badly?
- C: Because you know you have failed this day... failure is a lesson in its own way. I am not angry with you, no one is... and that, too, is something you will have to live with
- >Luna cries into your wing as you cradle her
- C: You did what you must for your little ponies. For better or for worse, but always for your ponies first
- >Always...